1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ostrovityanka [42]
3 years ago
7

Community funding may suffer when a company receive a _________ which may mean less money to pay for public service ​

Chemistry
1 answer:
vovikov84 [41]3 years ago
6 0

Answer:

Public substance abuse treatment programs have traditionally relied on three funding  Such an agency may already have funding to provide services to individuals  However, no such restrictions apply to payments received through manage.

You might be interested in
Convert 45.2 g to lbs
dangina [55]

Answer:

0.09964894 pounds

Explanation:

3 0
3 years ago
How toxic is uranium
Serhud [2]

Answer:

Inhaling large concentrations of uranium can cause lung cancer from the exposure to alpha particles. Uranium is also a toxic chemical, meaning that ingestion of uranium can cause kidney damage from its chemical properties much sooner than its radioactive properties would cause cancers of the bone or liver.

Explanation:

6 0
3 years ago
Read 2 more answers
Can someone help me on some of these question please : )
frez [133]
X-Ray used to Take images of teeth and bones.
Ultraviolet night vision goggle
4 0
4 years ago
Why vitamin A(retinol) transported by chylomicrons ?
OLga [1]

Answer:

from the small intestine (RE = retinyl ester; ROH = ret- inol. CM = chylomicron remnant). is split at least one intact molecule of retinol, retinal.

4 0
3 years ago
Pls help me will mark brainliest, chemistry equilibrium!!!
Sergeeva-Olga [200]

Answer:

See attached => LeChatelier's Principle

Explanation:

LeChatelier's Principle => If a stress is applied to a chemical reaction, the reaction chemistry will shift away from the applied stress and establish a new equilibrium having new concentration values different from the original concentration values.

There are three (3) principle stress factors that will cause disturb a chemical reaction and cause it to shift to establish a new equilibrium. These are ...

=> concentration effects,

=> temperature effects, and

=> pressure-volume effects.

The attached notes explain in general terms how to evaluate a chemical reaction under an applied stress factor and determine direction of shift to establish a new equilibrium stability. Compare and apply to the worksheet problems.

_______

Answers to worksheet (compare to attached notes)

1a. => increasing wt to product side => tilts right => shifts left

1b. => removing wt from reactant side => tilts right => shifts left,

1c. => increasing wt to product side => tilts right => shifts left

2a. => tilts left (excess wt from Hg), shifts right,

2b. => Increase pressure shifts toward lower molar gas volume side (right) Note: apply only to gas phase substances, Hg is in liquid phase.

3a. exothermic rxn => cooling => tilts left, rxn shifts right

3b. endothermic rxn => cooling => tilts right, rxn shifts left

3c. exothermic rxn => cooling => tilts left, rxn shifts right

_____________

don't forget => brainliest :-)

3 0
3 years ago
Other questions:
  • A concentrated solution has:
    8·1 answer
  • X2O3 contain 32% of oxygen by mass , find the value of x.
    9·1 answer
  • The periodic table shows that a carbon atom has six protons. This means that a carbon atom also has...
    10·2 answers
  • How many grams of diphosphorus trioxide are required to produce 10.2 moles of phosphorus acid
    6·1 answer
  • The element iodine forms a(n) _______ with the charge . The symbol for this ion is , and the name is . The number of electrons i
    11·1 answer
  • If you were to describe the shape of the Milky Way, what term would you use? A. Irregular galaxy B. Elliptical galaxy C. Barred-
    12·1 answer
  • Water in contact with air is acidic, rather than neutral,
    15·1 answer
  • Given the equation representing a system at equilibrium:Which statement describes the concentration of the two gases in this sys
    8·1 answer
  • Which sample of matter is classified as a substance
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!