1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saul85 [17]
2 years ago
15

If a person dies, how long untill "rigormortis"? (if that is how you spell it)

Biology
1 answer:
aivan3 [116]2 years ago
3 0

Answer:

About 1-2 hours after death.

Explanation:

Hope this helps :)

You might be interested in
Why does the DNA need to be extracted from a cell before it can be analyzed?
Arada [10]

Answer:

<em>To study the genetic causes of disease and for the development of diagnostics and drugs. And detecting bacteria and viruses in the environment and for determining paternity.</em>

<em></em>

5 0
2 years ago
Describe the structure of the ovule and the formation of the embryo sac
Bess [88]

Answer:

An embryo sac is said to form when the haploid megaspore nucleus divides. It possesses two haploid nuclei and six haploid cells which do not have cell walls.

Explanation:

7 0
3 years ago
Most of the known single-gene disorders are _____.
Firdavs [7]
Mendelian disorder is the known disorder of a single gene
8 0
3 years ago
How does tobacco smoke affect the body? A. It blocks hemoglobin from binding to carbon dioxide, thus affecting gas exchange in t
andriy [413]
All of the above, every answer is true
7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Other questions:
  • What is a plasmid? How is a plasmid used in gene splicing?
    9·2 answers
  • Place the steps of transcription in order:
    6·2 answers
  • Where would the temperature of the ocean,s surface water be the lowest?
    15·1 answer
  • • What characteristics are used to classify viruses?
    9·1 answer
  • Describe how phospholipids form a barrier between water inside the cell and water outside the cell
    15·1 answer
  • 1.) What is the carbon cycle?<br> 2.) What are the steps on photosynthesis?
    8·1 answer
  • How do animals and other heterotrophs get carbon
    12·1 answer
  • Streets that are parallel lines
    12·2 answers
  • Proteins are modified within ____
    5·1 answer
  • Suggest and explain two possible causes for the trends demonstrated in the graphic above.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!