1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mars1129 [50]
3 years ago
8

Which is not a characteristic of life? a) growth b) adaptation c) reproduction d) movement

Biology
1 answer:
Ber [7]3 years ago
7 0
Adaptation is not the characteristic of life
You might be interested in
The photo shows a boy and his parents.
stellarik [79]

Answer:

B

Explanation:

You can't change your DNA as far as I know and if you inherit exact copies of DNA from your parents that means you're a clone which human clones don't exist. You inherit genes from both your mother and father i.e you have blue eyes like your dad and brown hair like your mom.

5 0
3 years ago
PLS HELP 25 points
SSSSS [86.1K]

Answer:

C. Pseudo science is also known as 'fake science' because whatever is said is impossible to prove with the scientific method, and a pseudoscientist's mindset is that it's correct until proven wrong.

8 0
3 years ago
Which best decribes the realtion ship beetween dna and rna
GrogVix [38]

RNA is a copy of DNA that is used to make proteins. We usually compare all eukaryotic cells as a group to all prokaryotic cells.

7 0
3 years ago
Which lobe(s) of the brain are involved in driving a motor vehicle?
sdas [7]
FRONTAL LOBE are involved in that.....
7 0
3 years ago
1. Which statement best describes chromosomes?
Arlecino [84]

Answer:

A chromosome is an organized package of DNA found in the nucleus of the cell. Humans have 23 pairs of chromosomes--22 pairs of numbered chromosomes, called autosomes, and one pair of sex chromosomes, X and Y.

Explanation:

hope this is right for you.

8 0
2 years ago
Read 2 more answers
Other questions:
  • Which parts of the worm are included in the excretory system?
    13·1 answer
  • A big advantage of sexual reproduction is _________ variability in the offspring.
    5·2 answers
  • In general, why might ecologists be concerned when new invasive species arrive in an ecosystem?
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Scientists estimate that by the year 2025 the worlds population will reach
    10·1 answer
  • Most cells are visible to the unaided eye true or false
    12·1 answer
  • Help in the science pls (my gramm3er is dead)
    7·1 answer
  • Four of the five answers below are related by a common phase of mitosis. Select the exception. Group of answer choices chromosom
    9·1 answer
  • 6. Blood type is determined by three alleles, A, B, and O. Use the
    10·1 answer
  • The diagram represents one of Mendels laws or principles of inheritance. Which law or principle does the diagram represent? Domi
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!