1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mars1129 [50]
3 years ago
8

Which is not a characteristic of life? a) growth b) adaptation c) reproduction d) movement

Biology
1 answer:
Ber [7]3 years ago
7 0
Adaptation is not the characteristic of life
You might be interested in
How do sunflowers keep their regulation
tensa zangetsu [6.8K]
Here’s what I found about this

6 0
3 years ago
The widows peak that is seen in some people is an example of what type of trait?
Ksju [112]

Answer:

A. single-gene

Explanation:

It is controlled by a single gene that has two alleles. The allele for a widow's peak is dominant over the allele for a hairline with no peak.

5 0
3 years ago
How does the endocrine system change over a period?​
Alika [10]
Answer::: Brain structures called the hypothalamus and pituitary gland control the menstrual cycle. The hypothalamus triggers the pituitary gland to make hormones that trigger the ovaries to make oestrogen and progesterone. ... Disorders of the hypothalamus, pituitary gland or ovaries can affect menstruation, causing amenorrhoea
8 0
3 years ago
What Is the function of the coded Instructions contained in the body cells of an organism
Talja [164]

Answer: The function of the coded instructions contained in the body cells of an organism is called the Genes

Explanation:

6 0
3 years ago
Why do populations have variation of certain traits
HACTEHA [7]
To know where it rightfully belongs to. Variation of certain traits is caused by multiple factors of an individual of the same kind. Depending on their physical appearance, their environment and nature of survival.

Hope this might help.
3 0
3 years ago
Read 3 more answers
Other questions:
  • Which organism could be classified as a<br> fungus
    13·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • When gases move from an area of higher concentration to an area of lower concentration, it is known as ________.
    11·1 answer
  • Pleaseeee help!!!!!!!! I will mark you as brainlinest for correct answer!!!!!!!!!!
    14·1 answer
  • Global warming has been linked to a decrease in the
    7·2 answers
  • Why was the stethoscope invented?
    15·1 answer
  • If you multiply six positive numbers, the product sign will be
    6·1 answer
  • removing seeds from cotton plants was a slow job until eli whitney invented the cotton gin what is cotton gin
    8·1 answer
  • Which are not displayed on graph
    10·1 answer
  • Would a heart muscle cell have more mitochondria than other muscle cells? if so, why would this be?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!