1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
3 years ago
5

Who are the own children of Mr. and Mrs. Chan

Biology
1 answer:
Nutka1998 [239]3 years ago
3 0

Answer:

one is adopted and one is  the child from the mother's previous marriage.

Explanation:

You might be interested in
A cross involving true-breeding, red snapdragons and true-breeding, white snapdragons produce all pink offspring because both ge
stiks02 [169]

Answer: The correct answer for the blanks are- 1) Dominant and 2) Blending of the trait.

Incomplete dominance produces a blend/ intermediate phenotype of both the parental phenotypes ( such as Pink snapdragon here) because none of the parental allele completely masks the effect of other.

As per the given information in the question, when true-breeding, red snapdragons are crossed with true-breeding white snapdragons, they produce pink colored offspring. This means that neither of the parental gene is dominant over the other.

When both are cross bred, they will represent a heterozygous state ( when alleles for both the snapdragons are present ), and they will produce an intermediate phenotype ( that is a blend of both the traits). This represents blending of the parental trait.





5 0
3 years ago
Read 2 more answers
Whats the difference between osmosis and diffision
Anna35 [415]
The wheel while w is allow even. Xowowue S shekel d :$;$3
5 0
3 years ago
Read 2 more answers
Which of the following describes the different classifications of consumers in an ecosystems.
inessss [21]

Answer:

Herbivores are tertiary consumers. Carnivores are primary consumers. Omnivores are also primary consumers.

Explanation:

we got three types of consumers :

  • primary consumers
  • secondary consumers
  • tertiary consumers
4 0
3 years ago
Before the age of 4 months, an infant is likely to spit out semisolid foods because of:
Inessa [10]
The correct answer would be: The up-and-down motion of the tongue when sucking.


I hope that helped! c:
3 0
3 years ago
What is 3 reasons a species may become extinct?
jekas [21]
Three reasons a species could become extinct include, deforestation, being overhunted, not enough food available.
4 0
3 years ago
Other questions:
  • A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _____.
    13·1 answer
  • What are the possible ways that a mutation may affect an organism
    10·2 answers
  • once equilibrium is reached in which direction will molecules in a liquid state move across the membrane​
    7·1 answer
  • You could find ______ in sewage treatment plants.
    8·1 answer
  • Women with Turner syndrome (XO) and normal women (XX) are clearly different phenotypically. In addition, the vast majority of XO
    9·1 answer
  • Which of the following is true of fertilization in conifers?
    8·2 answers
  • Before Viewing<br> How would YOU define this word or term?
    6·1 answer
  • What is the type of allele that only affects the phenotype in the homozygous condition?
    11·1 answer
  • Question 4 (2 points)
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!