1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mojhsa [17]
2 years ago
9

How might the manipulation of DNA or RNA be used to treat disease?

Biology
1 answer:
zzz [600]2 years ago
5 0

Answer: With gene therapy

Explanation:

Manipulation of DNA or RNA is used to treat disease with gene therapy. This type of therapy is introducing genetic material into cells because it should compensate for abnormal genes or it should also make a beneficial protein.

Gene therapy is able in some cases to introduce a normal copy of the gene and after that, it can restore the function of the protein.

You might be interested in
What is the function of enzymes in cells​
Agata [3.3K]
Enzymes are biological molecules (typically proteins) that significantly speed up the rate of virtually all of the chemical reactions that take place within cells. They are vital for life and serve a wide range of important functions in the body, such as aiding in digestion and metabolism.
3 0
3 years ago
What beak shape do you think will be best for finding food in a period of abundant rainfall?
irina [24]

Answer:

Shorter beaks will be best for finding food in abundant rainfall.

3 0
2 years ago
The life process of reproduction refers to what
Lerok [7]

Answer:

the formation of new cells for the replacement and repair of old cells as well as for growth.

Explanation:

5 0
3 years ago
ATP is made of ribose, adenine, and _____.
olga_2 [115]
 (ATP) is comprised of an adenine ring, a ribose sugar, and three phosphate groups.
6 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • What do you observe happening to the wavelength and frequency of the wave under the spectrum as you slide the green arrow from l
    9·1 answer
  • HELPPP
    10·2 answers
  • Where does the sound of thunder come from??
    15·1 answer
  • Which level of organization is shown in the diagram?
    5·2 answers
  • Nuclear proteins having a molecular mass more than approximately 40 KDa must be actively imported through nuclear pore complexes
    13·1 answer
  • Pairs of genes that control the same trait are known as _____.
    14·1 answer
  • Need help asap
    10·2 answers
  • How are water molecules arranged in a liquid?
    9·2 answers
  • Why do you think leaves have stomata on their underside only? Explain.
    5·1 answer
  • I don’t understand how we can see the sky and clouds and when your outer space you don’t see the sky or clouds you only see the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!