1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babymother [125]
3 years ago
10

What are the major differences between Archaea and Eubacteria? 1.Archaea can live in extreme environments; Eubacteria cannot. 2.

Archaea have a true nucleus; Eubacteria do not. 3.The gene sequences of their rRNA are very different. 4.Archaea are much larger than Eubacteria.
Biology
1 answer:
Talja [164]3 years ago
6 0
<span>3.The gene sequences of their rRNA are very different. </span>
You might be interested in
The epidermis had a waxy coating that is called _____?
just olya [345]

Answer:

cuticle!

Explanation:

4 0
3 years ago
comparative profile for covid-19 cases from china and north america: clinical symptoms, comorbidities and disease biomarkers
Hatshy [7]

Different people are affected by COVID-19 in various ways. The symptoms experienced by infected individuals have ranged widely, from little discomfort to serious sickness.

  • The susceptibility to and prognosis of severe acute respiratory syndrome caused by coronavirus 2 or coronavirus disease 2019 (COVID-19) have been found to vary greatly amongst individuals and populations.
  • Intervention in public health must take into account these variations and how they affect susceptibility to infection and the severity of disease.
  • The distinctions between the COVID-19 case profiles from China and North America may be due to regional variations in host, environmental, and healthcare-related factors.
  • These inter-population variances, together with intra-population variability, highlight the need to identify how health inequities and inequalities affect the public health response to COVID-19 and can help with preparing for the epidemic's resurgence.

Learn more about the COVID-19 with the help of the given link:

brainly.com/question/28391554

#SPJ4

6 0
2 years ago
Xylem and Pholem are examples of _______________Plant cells function together to form______.
AveGali [126]
Answer:
            Xylem and phloem are the example of vascular tissue. Plant cell function together to form tissue.
5 0
4 years ago
Will be marked brainliest <br> Say something helpful for a broken heart
wlad13 [49]

Answer:

you're a nice person

Explanation:

<h3>your a wonderful person and you keep your words you dont let me down and your very intelligent ilu</h3>
7 0
3 years ago
The illustration below shows the steps of meiosis I.
Fantom [35]

Answer:

According to the illustration of meiosis I, when sister chromatids stay together the phase to which it corresponds is telophase I (fourth option).

Explanation:

Meisois is a process of cell division whose final result is the obtention of two daughter cells with half of their genetic charge, with respect to the original cell. This process is divided into two parts, called meiosis I and II.

Telophase I corresponds to the phase of cell division in meiosis I, where the events that occur are the appearance of the nuclear membrane on the newly divided genetic material, cytokinesis -or cytoplasmic division- and above all due to the fact that each daughter cell already contains half of the genetic load, since the sister chromatids stay together.

Explanation:

Can I please have brainliest?

Hope this helps!

6 0
3 years ago
Other questions:
  • Write as if you you were a chromosome...( a day in the life of a chromosome)
    11·1 answer
  • The driver of a truck carrying a radioactive substance accidentally came in contact with the material after getting into a crash
    6·2 answers
  • Pinnae are found in.<br>(a) Frog (b) Gasialis<br>(c) Rabbit<br>(d) Crow​
    5·1 answer
  • What is the goal of a conclusion?
    14·2 answers
  • A large-sample 98 percent confidence interval for the proportion of hotel reservations that are canceled on theintended arrival
    11·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Cross a red flowered plant and a white flowered plant. Flower color for these plants is incompletely dominant
    12·1 answer
  • what would be he the strand of complementary DNA produced be the strand of DNA shown below&gt; TCG AAG
    10·2 answers
  • The vesicles involved in endo/exocytosis are surrounded by a phospholipid membrane.
    9·2 answers
  • Plzz Help!! Do not do it for the points plz i really need help on this
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!