1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scrat [10]
4 years ago
5

`HOW DO CARBON CYCLE AND NITROGIEN CYCLE CONNECT

Biology
2 answers:
Alexxandr [17]4 years ago
5 0
Nitrogen released from dead matter goes into soil, helping/feeding the plants, who in turn give us oxygen
Rasek [7]4 years ago
3 0

The Nitrogen Cycle uses excretion to make NH3 (ammonia) Important processes in the carbon cycle are photosynthesis, deposition, and DECOMPOSITION. ... Carbon is then passed into the food chain and returned to the atmosphere by the respiration and decay of animals, plants, and other organisms.

You might be interested in
What is your opinion of the balance of nature hypothesis? Would deer on the island be better off, worse off, or about the same w
saveliy_v [14]

I think they would be worse of without wolves because wolves act as a natural selective pressure which favors the survival of the strongest deers. The second thing is that without a natural predator, the deer would probably reproduce in vast numbers which would reduce the amount of resources available for all deer on an island. It would eventually lead to their decay.

My deepest apology that it is not 3 paragraphs. I recommend to add more and state your opinion more clearly. That’s all

6 0
4 years ago
Adh helps to conserve water during dehydration. <br> a. True <br> b. False
AlladinOne [14]
The Anti-diuretic Hormone helps to control blood pressure by acting on the kidneys and the blood vessels. Its most important role is to conserve the fluid volume of your body by reducing the amount of water passed out in the urine. And so in times of dehydration it could help your body save more water. I think the statement is correct.
6 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What do the vessels that are
LenaWriter [7]

Answer:

B ) Valves

Explanation:

Valves allow blood to flow only in one direction and prevent the backflow.

7 0
3 years ago
A plant cell shrinks from the lack of water what term describes the environment outside the cell?
Llana [10]

Answer:

A hypertonic environment will result in cell shrinkage due to osmosis. However, this question is unclear because it's not the lack of water that causes shrinkage, it's the loss of cell water due to there being more concentrated aqueous particles outside of the cell vs. inside of the cell. I would still go with hypertonic though.

8 0
3 years ago
Other questions:
  • Which of the following can be best reasearchrd using a microscope
    7·2 answers
  • An adult body consists of about ________________ cells.
    10·1 answer
  • What are the causes of chemical weathering ?
    8·2 answers
  • The DNA double helix is antiparallel. This means that the two strands
    7·1 answer
  • A client with colitis inquires as to whether surgery eventually will be necessary. when teaching about the disease and its treat
    14·1 answer
  • A researcher is trying to produce a new cancer drug to be tested on small tumors. The tumor has to be localized in a small area
    9·1 answer
  • in a container filled with gas at a constant temperature, the volume is 183 mL and the pressure is at 310 mm Hg. The desired new
    12·2 answers
  • Spent nuclear fuel is ___________ reactive.
    6·1 answer
  • 4. Which of the following statements is true? *
    15·1 answer
  • A scientist plans to find out the cause of decrease in bird population in a location. He interviews 50 people who work in the lo
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!