1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bazaltina [42]
3 years ago
9

PLEASE HELPPP!! ILL GIVE BRAINLIEST AND 10 POINTS!!

Biology
1 answer:
alexgriva [62]3 years ago
7 0

Answer:

In all kinds of storms the coriolis effect cause the movement of water in the uppermost parts of the ocean also known as the ekman layer to create hills and valleys in the ocean topography or shape. Counterclockwise winds cause surface water to move to the right and away from a central point causing a sea surface valley. Clockwise winds cause surface water to move to the right and toward the central point causing a sea surface hill.      Thats all i know i hope i helped

Explanation:

You might be interested in
Summarize the hypothesized early atmosphere and experiments that suggest how the first "cells" may have evolved
Irina-Kira [14]
Two prokarioes mirged with each other 
8 0
4 years ago
6. Please choose the answer that describes the scientific notation for 5,098,000.
Alex73 [517]
Since for it to be in scientific notation it has to be between 1 and 10. So what I did is move the decimal point over the left six times to get 5.098 x 10^6. So that is the answer, hope i helped you out.
5 0
3 years ago
What is a chemical bond formed when atoms share electrons
aleksklad [387]
If atoms share two , three or more pairs of electrons..they are covalent bonds..for example, methane

if the atoms share only a lone pair of electron contributed by only one of the combining atoms but shared by both ..then it is a coordinate bond ..for example, ammonium ion
3 0
4 years ago
Read 2 more answers
What type of inheritance involves genes that segregate and assort independently?
Butoxors [25]

Mendelian inheritance involves genes that segregate and <u>assort independently</u>.

Independent Assortment- According to Mendel's law of independent assortment, the alleles of two or more distinct genes are separately selected into gametes. In other words, an allele with one gene doesn't really affect the allele for another gene that a gamete acquires.

Genes- The fundamental genetic component transferred from parent to kid. Genes are composed of <u>DNA </u>sequences and are organized sequentially at specified sites on chromosome in the cell nucleus.

DNA- The molecule found inside cells that carries the genetic material necessary for an organism to grow and operate. This knowledge may be handed down from one generations to the next thanks to DNA molecules.

To know more about the Independent Assortment, click on the below link.

brainly.com/question/13142132

#SPJ4

8 0
1 year ago
Which of the components could be observed using a microscope in a prepared slide of leaf epodermal cells but not in a preoared s
Jlenok [28]

<u>Answer:</u>

<em>Chloroplasts and Cell wall are the components which could be observed using a microscope</em><em> in a prepared slide of a leaf epidermal cells not in a prepared slide of himan cheek cells.</em>

<u>Explanation:</u>

<em>Chloroplasts is commonly known as a plastid which are contained in plants.</em> Chloroplasts contains chlorophyll and in the process photosynthesis is processed.

Cell wall is generally known for the surrounding of the cell as a border. <em>Cell wall is located just outside the cell membrane. </em>

3 0
4 years ago
Other questions:
  • what is a difference between atp and adp molecules?a)adp can be used to directly power movement, while atp cannot. b)atp molecul
    13·1 answer
  • According to the phylogeny tree, which phylum of organisms are most closely related to chordates?
    7·2 answers
  • A nucleosome forms hydrogen bonds with what part of the DNA? A nucleosome forms hydrogen bonds with what part of the DNA? only w
    14·2 answers
  • How does the possible impact of a chromosomal mutation that occurs?
    6·1 answer
  • Zoe made the following table to compare prokaryotic and eukaryotic cells.
    11·1 answer
  • Identify the phase of mitosis when two new nuclei form and the cell starts to pinch in the middle.
    13·1 answer
  • The dialysis tube was permeable to which substance? how did you determine this?
    12·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • ((60 POINTS!! PLEASE HELP)))
    12·1 answer
  • Phospholipids in a cell membrane are arranged so that the ______________ heads face the inside and outside of the cell where wat
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!