1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Misha Larkins [42]
2 years ago
7

give me the Definition of Parasitism, Commensalism, and Mutualism and an example of each word please please actually answer

Biology
1 answer:
Andrej [43]2 years ago
4 0

answer:

sample answer below.

explanation:

<u>parasitism</u>

  • the practice of living as a parasite in or on another organism
  • example: fleas or ticks that live on dogs and cats are parasites. they are living off of the blood of the host animal

<u>commensalism</u>

  • an association between two organisms in which one benefits and the other derives neither benefit nor harm
  • example: a golden jackal (the commensal) following a tiger (the host) to feed on leftovers from its kills

<u>mutualism</u>

  • the ecological interaction between two or more species where each species has a net benefit
  • example: one example of a mutualistic relationship is that of the oxpecker (a kind of bird) and the rhinoceros or zebra. the oxpeckers get food and the beasts get pest control
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Which of these flowers do you think is a sunflower? Check all that apply.
alexandr402 [8]
I think the last two ? lol
3 0
2 years ago
Read 2 more answers
Camille and her friends enjoy experimenting with different foods. During a camping trip, they decide to fry bacon using nothing
Fantom [35]
<span>The two sentences that accurately describe the girls' experience with heat transfer are "Camille heats a rock in the campfire for 30 minutes, and then removes it with tongs. She greases the rock and lays the bacon strips directly on it." By heating the rocks in the campfire and laying the bacon on the rocks, the girls transferred the heat from the fire to the rocks, and the heat from the rocks to cook the bacon.</span>
5 0
3 years ago
Read 2 more answers
(first one to answer gets brainliest!), What % of wind energy does the United States use?
Ber [7]

Answer:

Although wind makes up about 8% of total U.S. electricity generating capacity, wind generators provided a smaller share (5%) of total U.S. electricity generation in 2016 because wind turbines have relatively low capacity factors.

Explanation:

3 0
2 years ago
Some members of the Euglenids are photosynthetic, yet they will lose their photosynthetic pigment if left in the dark. True or F
irga5000 [103]

A) Some members of the Euglenoids lose their photosynthetic pigment when left in Dark : TRUE

B )The loss of photosynthetic pigment in Euglenids stored in the dark is permanent : False

<h3>What are Euglenas</h3>

Euglenas are unicellular organisms belonging to the kingdom Protista, when kept in the dark for too long Euglenoids begin to lose their chlorophyll. As it loses its chlorophyll it becomes unable to produce its own food and starts consuming bacterias within its habitat.

The loss of chlorophyll in Euglenids can be regained after it is been exposed to sunlight and allowed  to grow exponentially for several weeks.

Hence we can conclude that  Some members of the Euglenoids lose their photosynthetic pigment when left in Dark : TRUE  while The loss of photosynthetic pigment in Euglenids stored in the dark is permanent : False

Learn more about Euglenoids : brainly.com/question/1278307

8 0
2 years ago
Other questions:
  • Animals are totally dependent on plants and microorganisms for nitrogen fixation and nitrate assimilation because animals: A. do
    12·1 answer
  • When walking home, a neighbor's large, aggressive dog gets loose and begins chasing you. you begin running to flee from the dog,
    5·1 answer
  • Which of these is a type of mass movement that is likely to happen after a large amount of rain?
    5·1 answer
  • Когда исчезнет человечества?
    13·1 answer
  • Help pls. ive been stuck on this for a long time
    6·1 answer
  • How do roots and seeds get energy?​
    12·2 answers
  • Mr. Krabs created a secret ingredient for a breath mint that he thinks will “cure” the bad breath people get from eating crabby
    12·2 answers
  • HELP. Asap! Answer question in photo
    10·1 answer
  • If you pressed a stethoscope diaphragm firmly on a volunteer's skin at the following locations on the right side of the body: In
    6·1 answer
  • Help please Confusing
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!