1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SpyIntel [72]
2 years ago
5

The blue cell in the cartoon would be classified as what type of cell?

Biology
2 answers:
romanna [79]2 years ago
8 0

B. eukaryotic because it’s living
Fofino [41]2 years ago
5 0

Answer:

The blue cell in the cartooon would be calssified as prokaryotic.

You might be interested in
GIVING MY 1491 POINTS AWAY (IN PORTIONS) 30 POINTS THIS TIME!
natka813 [3]

Answer:

its a living thing ;)

Explanation:

3 0
2 years ago
Read 2 more answers
How many elements have been found to occur in nature? 90 92 96 99
belka [17]
92 are the elements found 
7 0
3 years ago
Read 2 more answers
When molecules have an uneven distribution of charges they are said to be
kobusy [5.1K]
Polar molecules i believe
8 0
3 years ago
Which is a type of epithelial tissue? A) The skin on your hand B) cardiac muscle C) neurons D) cartilage?
andriy [413]
The skin on your hand.
8 0
3 years ago
which of the following correctly describes homeostasis in protists? (A) Paramecium maintain homeostasis by swelling and bursting
natulia [17]
B) Vacuoles allow water to enter and exit the paramecium.
8 0
3 years ago
Other questions:
  • What happens when your diaphragm relaxes and moves upward?
    14·1 answer
  • What is the equation of photosynthesis?
    5·1 answer
  • What is the factor that is passed from parent to offspring
    14·1 answer
  • What part of the conduction system might be at risk for abnormalities with vsd?
    15·1 answer
  • Cancer can result from disruptions in cell cycle control. Mutations that increase the production of EGFR have been associated wi
    10·1 answer
  • QUESTION 6 What is the relationship between genes and alleles? Genes carry instructions for proteins that express traits. Allele
    13·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which of the following best describes the role that herbivores play in an ecosystem?
    15·2 answers
  • How is hyaline cartilage different from elastic or fibrocartilage?
    7·1 answer
  • Dichotomous jets and branching diagrams organize different types of information about classification. How are these tools used d
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!