1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gemiola [76]
3 years ago
6

Please Help

Biology
1 answer:
sveticcg [70]3 years ago
4 0

Answer:

A. Wind

wind is a renewable resource because there is unlimited supply of it.

Explanation:

You might be interested in
1. If a pea plant’s alleles for height are tt, what is true of its parents?
omeli [17]
1. C) Both parents contributed a recessive allele
The offspring is homozygous for the recessive allele, which means it has two copies of it. Because each parent contributes one copy of the gene, this means that both parents contributed the recessive allele.

2. D) The offspring can be tall or short

The first cross between TT and tt will yield an F1 generation with the genotype Tt. When this generation is self-pollinated, the cross may result in the following genotypes:
TT, Tt, tt
Which means that the offspring can be tall or short.
4 0
3 years ago
A forensic anthropologist examines the upper arm bones of a single individual. She notes that the diameter (thickness) of the le
Furkat [3]

Answer:

The use of left arm is more compared to right hand

Explanation:

In the given question, the anthropologist when examines the left and right arm he found that the left arm is thicker than the right arm.

The more thickness of the left arm signifies that the person uses his left arm for the muscular work as the more use of hand increases the deposition of the calcium phosphate and sulfate in bones along with other material which increases the thickness for the bones and increases the strength.

Thus, The use of the left arm is more compared to the right hand is correct.

7 0
3 years ago
True or false Cycads are mostly found in tropical regions
egoroff_w [7]

Answer:

true i think

Explanation:

5 0
2 years ago
Choose a plant tissue. Write an explanation of how that tissue’s structure relates to its function. Be specific and detailed.
LenKa [72]

There are two types of plant tissues: meristematic tissue found in plant regions of continuous cell division and growth, and permanent (or non-meristematic) tissue consisting of cells that are no longer actively dividing.Meristems produce cells that differentiate into three secondary tissue types: dermal tissue which covers and protects the plant, vascular tissue which transports water, minerals, and sugars and ground tissue which serves as a site for photosynthesis, supports vascular tissue, and stores nutrients.Vascular tissue is made of xylem tissue which transports water and nutrients from the roots to different parts of the plant and phloem tissue which transports organic compounds from the site of photosynthesis to other parts of the plant.The xylem and phloem always lie next to each other forming a structure called a vascular bundle in stems and a vascular stele or vascular cylinder in roots.Parts of the shoot system include the vegetative parts, such as the leaves and the stems, and the reproductive parts, such as the flowers and fruits.

6 0
3 years ago
The term meaning the freeing of a kidney from adhesions is:
Valentin [98]

Answer:

Ureteroplasty is surgery to remove the stricture.

Explanation:

6 0
2 years ago
Other questions:
  • Cells use vesicles to transport substances with?
    11·1 answer
  • I WILL GIVE BRAINLIEST Give an example of an adaptation within a population (micro-evolution) that has been observed or research
    8·1 answer
  • Compare the physical and chemical properties of a compound to those of the elements of which it is composed.
    9·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Where would you start when describing the blood flow through the circulatory system? (mainly the heart) I need to know because I
    10·1 answer
  • Many farmers and gardeners compost their plant and animal waste. The living material naturally decays in compost bins, forming a
    6·2 answers
  • Where can we find physical evidence to support the theory of evolution?
    7·1 answer
  • Jezelyn needs to create a project that shows geographic isolation in action and decides to make a video. Which of the following
    5·1 answer
  • Describe how the action of the action of the mouth,aesphogus and stomach contribute to the digestion of food
    7·1 answer
  • What is a chain of molecules linked with peptide bonds
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!