The anterior side of the heart is the side the uppermost point or peak is pointing to. The posterior surface lies opposite to the uppermost point.
<h3>What is heart?</h3>
The heart is a fist-sized organ that is located around the chest region or breast bone that pumps blood to the body. It's the primary organ of the circulatory system. The heart have four main chambers made of muscle and powered by electrical impulses. The brain and nervous system influence heart's function.
Therefore, The anterior side of the heart is the side the uppermost point or peak is pointing to. The posterior surface lies opposite to the uppermost point.
Learn more about heart here.
brainly.com/question/26387166
The answer to the first spot is 24.
The answer to the second spot is f<span>ertilizes</span>.
I hope this helps.
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
All of the chemical reactions in an organism required to sustain life so C
Answer:
The preferable options will be -
T-tubule system
Explanation:
- T-tubules or transverse tubules are a part of the skeletal and cardiac muscle membrane systems. They are the cell membrane extensions that can penetrate into the center of those muscles.
- It contains a large amount of on channels, transporters, and pumps. It allows the transmission of the action potential, frequently. T-tubules also regulates the cellular calcium concentration.
