1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kap26 [50]
3 years ago
5

Which can be used to estimate time of death?(check ALL that apply)

Biology
2 answers:
Fofino [41]3 years ago
5 0

Answer:

Lividity

Explanation:

This makes the most sense to me.

Good Luck!

alexandr1967 [171]3 years ago
3 0

Answer:

lividity is the answer

Explanation:

lividity is the bluish - purple discolouration of skin after death . it is a common sigh associated with livor Mortis etc

You might be interested in
The ________ duct carries tears in the eye to the nose.
iris [78.8K]
Hi this is called the nasolacrimal duct that carries tears in the eye to the nose.
Hope this helped please name this brainiest thanks.
5 0
4 years ago
Look at this picture! Can you tell what type of stone that is?
Leno4ka [110]

Answer:

Explanation:

sedimentary rock

you can see layers in the rock

3 0
2 years ago
Why is it beneficial to use textiles made from synthetic fibers
mestny [16]
Synthetic fabrics<span> are </span>textiles made<span> from man-</span>made fibers<span> rather than natural </span>fibers. Chemically produced fabrics<span> are </span>made<span> by joining monomers into polymers, through a process called polymerization. A </span>synthetic fabric<span>, when magnified, looks like plastic spun together.</span><span>

Natural fabrics, such as cotton, silk, and wool, are made from animals or plant based fibers. While synthetic are man made and produced entirely from chemicals to create fabrics. such as polyester, rayon, acrylic, and more. The benefits of using textiles made from synthetic fibers is that it saves the animals and plants that the fibers are based off of. 

Hope this helped :)

</span>
5 0
4 years ago
What type of microscope gives the highest amount of magnification?
umka2103 [35]
Optical microscope.
Hope this helps.
4 0
3 years ago
Read 2 more answers
List the four steps needed to extract Dna
dalvyx [7]
As an example I will tell you how to extract DNA from peas

1. Blender insanity 
<span>The blender separates the pea cells from each other, so you now have a really thin pea-cell soup
</span>2. Soapy peas

3. Enzyme Power

4. Alcohol Seperation 
5 0
3 years ago
Other questions:
  • _______ is (are) associated with permafrost
    5·1 answer
  • Describe the flow of water from the north Atlantic through the rest of the oceans
    12·1 answer
  • What is a characteristic of a stable environment?
    10·2 answers
  • If a uniform becomes saturated with blood, what is the proper action that should be taken for the athlete to continue participat
    6·1 answer
  • How high is this baby on LSD?​
    15·1 answer
  • What are silver carp strengths and weaknesses?
    11·1 answer
  • Fill in the blanks below with the correct word to complete the sentence.
    8·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Lots of points any one knos
    13·1 answer
  • Which was not a result of the 1898 discovery of the four blood types and advances made during the two World Wars? improved blood
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!