1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
3 years ago
6

Which energy source would a food producer who wants to follow the spirit of the farm to fork concept

Biology
1 answer:
xenn [34]3 years ago
4 0
I believe the answer should be solar
You might be interested in
The Hardy–Weinberg equilibrium model states that allele and genotype frequencies in a population will remain constant from gener
olga_2 [115]
THE ANSWER IS C.) MITOTIC DIVISON



I GOT IT RIGHT ON USATESTPREP...
6 0
4 years ago
Read 2 more answers
Match each branch of science with its related carrier
spayn [35]
D.) = 1.)
A.) = 3.)
C.) = 2.)
B.) = 4.)
6 0
3 years ago
Read 2 more answers
If the outside temperature decreases by 20 degrees Celsius, what will happen to a reptile’s body temperature?
oksian1 [2.3K]

The reptile's body temperature rises when the external temperature rises. When the temperature drops, so does his body temperature. If a reptile feels cold because the external temperatures have made his blood cold, he'll lie in the sun to warm up. However, if the external temperature is too high, he scurries under a rock, dives in a pool or finds some kind of shade where he can cool down. Reptiles and other animals with ectothermic systems are vulnerable to extreme changes in temperature because they can't control their temperatures internally. They can control their body temperatures only by moving to an environment with a suitable ambient temperature.

6 0
4 years ago
Which of these is not produced in the Calvin Cycle?
lions [1.4K]
NADPH i think it’s that
4 0
3 years ago
What does glucose mean?
Sergeeva-Olga [200]

Answer:a simple sugar which is an important energy source in living organisms and is a component of many carbohydrates:

Painic-stricken, handle business, not a joke, yeah

Manners missing, travel different, no control, yeah

Time to listen, time to zip it, keep it closed

My description, highly gifted, take some notes, yeah

Lack of interest, why'd you visit? Hit the road, yeah

I'm kinda twisted, so keep your distance, be a ghost

Yeah, see I'm inventive, but quite the menace, you ain't know?

Well then I'm offended, let's jog your memories, here we go, yeah

I went from nobody to kinda famous

Explanation:

8 0
4 years ago
Other questions:
  • Which of the following statements is consistent with the principle of competitive exclusion? Which of the following statements i
    7·1 answer
  • What makes platelet?
    8·1 answer
  • A stable atom with a neutral charge has the same number of
    10·1 answer
  • What is the difference between endocrine and exocrine glands?
    14·1 answer
  • Please tell the different parts of breast with diagram​​
    5·1 answer
  • Which type of mutation results in receiving an extra chromosome?
    8·2 answers
  • Sharks typically ſeproduce sexually. A particular female shark, however, gave birth in a zoo despite having
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A prism is a clear glass pyramid with identical faces. What happens when white light is shined on a prism?
    13·1 answer
  • Well labeled diagram of a tapewom
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!