1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erica [24]
4 years ago
15

Which three statements correctly describe the endoplasmic reticulum?

Biology
1 answer:
Sunny_sXe [5.5K]4 years ago
5 0

I have searched everywhere, but I have not found the proposals of the question, but I will explain to you what is the endoplasmic reticulum so that you can answer it.

The endoplasmic reticulum is a eukaryotic organelle located in the cytoplasm.

The endoplasmic reticulum is a network of membrane tubules (often interconnected) scattered throughout the cytoplasm of eukaryotic cells. Its membrane, which alone represents more than half of the cellular membrane system, is in contact with the nuclear envelope.

The endoplasmic reticulum can be:

Granular (or rough) (RER) that is to say associated with ribosomes.

Smooth (SER).

The granular endoplasmic reticulum is the place of synthesis (in the associated ribosomes) of the proteins secreted outside the cell and of the proteins and lipids constituting the membranes of the cellular organelles. Golgi, lysosomes, mitochondria, nucleus, ribosomes, vesicles ...). It participates in the correct folding of the proteins that have just been synthesized.

The smooth endoplasmic reticulum participates in cellular metabolism, synthesizing lipids and storing calcium.

You might be interested in
Which term refers to the process by which individuals that are better adapted to their environment are more likely to survive an
olga_2 [115]
<span>Which term refers to the process by which individuals that are better adapted to their environment are more likely to survive and reproduce? The correct answer is A. natural selection. 
</span>
6 0
3 years ago
Read 2 more answers
Red blood cells float in blood plasma. What kind of mixture is blood?
Alexeev081 [22]
Colloid is the mixture of red blood cells that is floting with plasma. This is in the body.
5 0
4 years ago
Read 2 more answers
How do i fo this question
svet-max [94.6K]

Answer:

Selection pressure means factors that contribute to selection which variations will provide the individual with an increase chance of surviving over others. Because of selective pressures, organisms with certain phenotypes have an advantage when it comes to survival and reproduction. Over time, this leads to evolution.

Explanation:

i hope this helps bc i think its D. not entirely sure.

3 0
3 years ago
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
How could stem cells prove helpful in the treatment of cardiovascular diseases? A) Stem cells can differentiate to form heart mu
Akimi4 [234]

Answer:

A

Explanation:

Cardiovascular diseases involves the heart.

Any of the above options with regards to blood (etc, white blood cells, red blood cells) are related to circulatory system, not affecting the function of the heart.

Stem cells performing apoptosis to remove old cells is a myth. Stem cells can only differentiate to form cells of the same lineage, not causing other cells to undergo apoptosis. The only external factor that can cause cells to undergo apoptosis is a type lymphocyte in the immune system

7 0
3 years ago
Other questions:
  • "a female peacock is checking out the potential mates" - males with excellent plumage displays. when she sees a male with vibran
    10·2 answers
  • One dangerous consequence of very-low-calorie diets is that they increase the individual's risk for a condition in which the blo
    6·1 answer
  • Humans only have a few eye colors and only four abo-based blood types. how can dna tests definitively identify individuals when
    5·2 answers
  • ______ causes diffusion of new water molecules out of the xylem and into the leaf.
    5·2 answers
  • I need answers to this worksheet!
    10·1 answer
  • Anything will help <br> Biology
    5·2 answers
  • The relationship between the amount of energy available for use and the amount of entropy in a food chain differs between trophi
    5·2 answers
  • Predator populations decrease if the number of prey increases. true or false
    10·1 answer
  • What are the factors that influence soil formation? List all of thyme and their effects .
    12·1 answer
  • based on the results of the experiment what can you infer or the habitat characteristics necessary to provide the highest health
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!