1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Archy [21]
3 years ago
13

Which is used by scientists to find out how different species are related?

Biology
1 answer:
IRINA_888 [86]3 years ago
3 0
The answer would be c this would show relations
You might be interested in
What is the molar mass of sodium bicarbonate, in g/mol? Your answer should have the appropriate number of significant figures (u
Dmitry_Shevchenko [17]

Answer: 105.96

Explanation:

Sodium bicarbonate (Na2CO3)

Atomic mass of Sodium (Na) = 22.99

Atomic mass of Carbon (C) = 12.01

Atomic mass of oxygen = 15.99

Na2CO3 has a molar mass of (22.99x2) + 12.01 + (15.99x3) which is equal to

45.98 + 12.01 + 47.97 = 105.96

Thus, the molar mass of sodium bicarbonate is 105.96g/mol

3 0
3 years ago
Read 2 more answers
74) one difference between cancer cells and normal cells is that cancer cells; a) are unable to synthesize dna.; b) are arrested
Natasha_Volkova [10]
C. <span>continue to divide even when they are tightly packed together.
Hope this helps(;</span>
3 0
3 years ago
How is solar energy good for us?
Vesna [10]
It's natural from the sun and it doesn't use any of the earths resources therefore saving the environment
4 0
3 years ago
Read 2 more answers
You put a marshmellow on a metal coat hanger and roast the marshmellow over an open fire. The marshmellow catches on fire. You q
Andrew [12]

Answer: Conduction

Explanation: As the fire starts to heat up the metal hanger it transfers the heat onto your hand.

Conduction Def: The process by which heat or electricity is directly transmitted through a substance

7 0
3 years ago
Why social relationships are necessary for the survival of human being​
prisoha [69]

Answer:

They help you live longer

Explanation:

Research has shown that social connections not only impact your mental health, but your physical health as well. A review of 148 studies (308,849 participants) indicated that individuals with stronger social relationships had a 50% increased likelihood of survival.

3 0
3 years ago
Other questions:
  • A scientist wrote a paper titled “Directional Selection in Action” after observing a population of mice for 15 years. The mice t
    11·1 answer
  • Explain what happens inside your body as you give an oral report in front of your class
    10·1 answer
  • Which of the following is an ectothermic vertebrate
    6·2 answers
  • What three continents does the tropic of cancer pass through?
    8·1 answer
  • What will happen when the global carrying capacity for humans is reached?
    13·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Why do different kinds of control mechanisms exist?
    6·1 answer
  • What is the main purpose of the nervous system?
    8·1 answer
  • bservations of organisms include descriptions of why the organism has certain traits. descriptions of the number, size, and arra
    6·1 answer
  • What evidence suggests that birds evolved from theropod dinosaurs?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!