1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KATRIN_1 [288]
2 years ago
6

If b is a recessive gene, list the offspring that will exhibit or show the recessive trait.

Biology
1 answer:
babymother [125]2 years ago
8 0

Answer:

Not sure if theres supposed to be a pic or chart with this but if its any help, recessive traits only show when theres no dominant traits present and both parents need recessive genes

You might be interested in
What causes primary succession
shepuryov [24]
Primary succession occurs when vegetation occurs in a place for the very first time, i.e there was no vegetation there before.

The causes are:


-Erosion

-Physiography

-Elevation
3 0
3 years ago
Why is good habitat important for animals?
Setler [38]
Because if animals dint have a good habitat they wont have a desent place to bd in
6 0
3 years ago
Buony
sasho [114]
My lg is driplikemessiah and just look up the
4 0
2 years ago
Which one of these is not a characteristic of a hypothesis?
weqwewe [10]

Answer:

Uhh-

Explanation:

Bruh there's no pic so ... I dunno lol. Just in case this helps you, hypothesis means an educated guess. There's different meanings, for science it's an idea. But mostly it means guessing.

I didn't help Ik XD

And

Sorry

I

Couldn't

Helppp

.............

:(

3 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • What's the meaning of bio​
    8·1 answer
  • Which outcome is the main function of the light-independent reactions of photosynthesis?
    12·2 answers
  • Which of the following answers describes the correct sequence of events in the cell cycle, starting with cell division?
    8·1 answer
  • F a gene is inserted or deleted in a genome, these events can lead to new alleles forming that may cause variation within a spec
    14·1 answer
  • What phyllum,order,family genus and species are humans?
    6·1 answer
  • How to minimize flood​
    11·2 answers
  • Matthew was bowling. He bowled with a 12 pound ball at first then used a 10 pound ball. If matthew uses the same amount of force
    13·1 answer
  • Question 9 of 17
    8·1 answer
  • What skill is a scientist using when she listens to the sounds that an elephant makes?
    6·1 answer
  • Which best explains why it is difficult to classify protists?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!