1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leya [2.2K]
3 years ago
14

Check my answers?

Biology
2 answers:
Kay [80]3 years ago
6 0

Answer:

1) building over habitats

2)decreasing boidiversity

3)biodiversity

4) preserve an ecosystem

5)the water is too warm

Explanation:

Lisa [10]3 years ago
5 0

Answer:

  1. D
  2. A
  3. C
  4. D
  5. B .
<h3>explanation:</h3>

Hope this helps

You might be interested in
____ means finding a locations based on its distance from three other locations
tekilochka [14]

It's either longitude or absolute location. Sorry if these aren't correct.

8 0
3 years ago
1. What is the cell?
slavikrds [6]

Answer: Cells are the basic building blocks of all living things. The human body is composed of trillions of cells. ... Cells have many parts, each with a different function. Some of these parts, called organelles, are specialized structures that perform certain tasks within the cell.

Explanation:

3 0
3 years ago
Roman says that the risk of osteoporosis can be reduced by making certain lifestyle choices. Which lifestyle choice could Roman
Brrunno [24]

Answer:

increasing calcium intake

Explanation:

5 0
2 years ago
A science classs is studying an organism. Using a microscope, the class observed that the cells have nuclei and chloroplasts. In
const2013 [10]

Answer:

Eukarya

Explanation:

According to the given information, the observed cells have nuclei and chloroplasts. The presence of a well-defined nucleus and other membrane-bound organelles such as chloroplasts is a feature of eukaryotic cells. All the eukaryotic organisms are assigned to the Domain Eukarya. Therefore, the observed cells belong to the domain Eukarya. Due to the presence of chloroplasts in them, these cells may belong to the kingdom Plantae of domain Eukarya. Domains Archaea and Bacteria include prokaryotic organisms.

5 0
3 years ago
Two frog populations (same species) living in two neighboring lakes sing slightly different courtship songs. increased irrigatio
Contact [7]

The best answers for this question would be:

 

 The songs will become more similar to each other.

 

<span>The frogs have most likely sync their songs with each other, since the female cannot determine the range of the song of the male frog given the environment that they are living in.</span>

7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the main role of a hormone?
    11·1 answer
  • Which of the following is an object used in relative dating?
    14·2 answers
  • What might the student look for under a microscope are plant cells or animal cells?
    13·1 answer
  • How does the atmosphere protect life on Earth
    9·1 answer
  • Plz help me with question
    12·1 answer
  • Is black coffee an element compound or mixture
    8·1 answer
  • You might find _____ in the Arctic.
    13·2 answers
  • Mutations that hinder the survival of an organism
    14·1 answer
  • Hello people ~
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!