1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djverab [1.8K]
3 years ago
7

Reconstruction of the crime is done

Law
1 answer:
slamgirl [31]3 years ago
6 0
At the crime scene as soon as possible.
You might be interested in
Who decides whether a suspect will be tried for an alleged crime?
Lerok [7]

Answer:

the judge

Explanation:

i looked it up

don't trust me tho

3 0
3 years ago
Read 2 more answers
What is the minimum age to run for u.s hous of representatives
liubo4ka [24]

Answer:

3 ggggggggggggggggggggggggg

7 0
3 years ago
Read 2 more answers
A major cause of fatal traffic accidents in Tennessee is​
vagabundo [1.1K]

Answer:a law sue

Explanation:

7 0
3 years ago
Any know here about priya darshini​
garri49 [273]

Answer:

Nope sorry

Explanation:

7 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • Based on your reading of the following, how much education is required after high school to become a firefighter?
    10·1 answer
  • I need your help!!! Please
    10·1 answer
  • How are judicial activism and judicial review related?
    10·2 answers
  • These attorneys have a high turnover rate and are known for learning the job
    5·2 answers
  • 22. Some statistics show that a boy who watches his father hit his mother is more likely to hit his own spc
    9·1 answer
  • Explain the major difference between the concept "big" government versus the concept of "small" government
    6·1 answer
  • When threats are used to convince a party to sign a contract, it is known as
    9·1 answer
  • Congratulations! You were just informed that you are the new Police Chief in a rather large city where an officer-involved shoot
    11·1 answer
  • How are your rights supported or limited
    10·1 answer
  • A fragment of glass was found on the back of a suspect’s sweatshirt. At the crime scene, there was a window that was broken. Wha
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!