1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
love history [14]
3 years ago
5

Which of the following best describes these

Biology
1 answer:
Nikitich [7]3 years ago
8 0

Answer:B

Explanation:

Because i know it

You might be interested in
What feature on the microscope should you adjust so that you can see properly?
jek_recluse [69]

Answer:

Condenser adjustment

Explanation:

As a general rule, do NOT touch or adjust this knob. It controls how far the light condenser is from the slide, which should be properly adjusted before you use the microscope. If you move it, you will have it in the wrong position. If your scope has the knob, find out where it is and avoid it.

4 0
2 years ago
Why doesn't water become saltier when it comes down from the clouds
Julli [10]
The salt evaporates in the air thus when it hits the ground
7 0
3 years ago
Why is transcription essential for making proteins
Kryger [21]

Messenger RNA (mRNA) molecules carry the coding sequences for protein synthesis and are called transcripts; ribosomal RNA (rRNA) molecules form the core of a cell's ribosomes (the structures in which protein synthesis takes place); and transfer RNA (tRNA) molecules carry amino acids to the ribosomes during protein synthesis. In eukaryotic cells, each class of RNA has its own polymerase, whereas in prokaryotic cells, a single RNA polymerase synthesizes the different class of RNA. Other types of RNA also exist but are not as well understood, although they appear to play regulatory roles in gene expression and also be involved in protection against invading viruses.

5 0
3 years ago
Read 2 more answers
A valid scientific investigation must be able to be
san4es73 [151]
Answer: in order for a scientific investigation to be valid A hypothesis must be tested throughout a Scientific investigation that can gather evidence and support it.

Explanation: in any scientific investigation you have to have a testable hypothesis, without your hypothesis it’s not really a scientific investigation.


Hope this helped!
7 0
3 years ago
How can natural selection occur in a population over time?<br><br> help as soon as possible
Ronch [10]
Over time, those who cannot live through the temperature differences/have undesirable qualities will die off. Overtime, those with desirable qualities are left and they will continue the population.
4 0
2 years ago
Other questions:
  • List and describe 3 molecular methods used to analyze DNA in a laboratory.
    9·1 answer
  • There are six kingdoms of living things. Archaebacteria is one of these kingdoms. Which choices are also kingdoms of living thin
    9·1 answer
  • How does DNA control the functions of an organism?
    10·1 answer
  • How dose a universal genetic code relate to the hypothesis about the origin of life on earth
    9·1 answer
  • What are real life examples of ribosomes
    5·2 answers
  • A species that is likely in the near future to become endangered would best be characterized as which of the following?
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What benefit did land plants offer as they became more abundant ?
    9·1 answer
  • According to the cladogram, which feature is present in primates, but not amphibians?
    9·1 answer
  • Can someone plzz help me on this its hard:( ill give brainliest
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!