1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skelet666 [1.2K]
3 years ago
8

Mrs. Rushing fills a balloon with hydrogen gas to demonstrate its ability to burn. Which combination could she use to produce th

e hydrogen she needs? NaOH and oil Zn and KOH H2SO4 and CaCO3 Mg and HCl
Chemistry
2 answers:
WITCHER [35]3 years ago
4 0

Answer:

Mg and HCI :)

Explanation:

ale4655 [162]3 years ago
3 0

Answer:

Mg and HCI

Explanation:

You might be interested in
What is photosynthesis ? ​
schepotkina [342]

Answer:

Photosynthesis is the process used by plants, algae and certain bacteria to harness energy from sunlight and turn it into chemical energy.

Explanation:

Mark me as brainliest

7 0
3 years ago
The steps in every scientific investigation must_______________________.
Marizza181 [45]

Answer:

B. begin with a hypothesis

Explanation:

6 0
3 years ago
The boat shown in the photo below is moving along at a constant 20 miles per hour. Is the boat accelerating? Question 3 options:
SVETLANKA909090 [29]

Answer:

A

Explanation:

If its going at a constant speed it will not accelarate wich means to speed up.

4 0
3 years ago
Describe what happens when a bond is created between magnesium and bromine. Be specific and explain in terms of electrons.
Allushta [10]

Answer: Magnesium and Bromine/MgBr2 = Ionic compounds

Explanation: When atoms form together they can form between Ionic Compounds and molecules; this could depend on if they're joined by Covalent bonds as well because when atoms form with Covalent bonds, it forms Molecules.

5 0
3 years ago
Click to select the correct answers. Click again to unselect answers. Leave the incorrect answers unselected.
ICE Princess25 [194]
Correct answers:
<span>Nuclear fission and fusion both affect the nucleus of an atom. 

</span><span>The final products of fission and fusion are elements that are different than the original.

</span><span>Fission occurs mostly with elements heavier than lead on the periodic table.</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which is the best example of translate translational motion
    10·1 answer
  • Radiation can cause long-term problems once it enters the environment.
    14·1 answer
  • For the same mixture, under the same conditions described in problem 7, calculate keq for 2nh3 (g) n2 (g) + 3h2(g). how is the k
    5·1 answer
  • The boiling point of an aqueous 1.83 m (nh4)2so4 (molar mass = 132.15 g/mol) solution is 102.5°c. determine the value of the van
    9·1 answer
  • What ions would you expect to find when an acid dissolves in water?
    7·1 answer
  • Al2(SO4)3+Mg(NO3)2⟶ What would be the product(s) of this reaction? *These are NOT balanced, just look for the correct products*
    14·1 answer
  • he specific heat capacity of a pure substance can be found by dividing the heat needed to change the temperature of a sample of
    12·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Ay
    10·1 answer
  • Someone help <br> What are the products in a chemical reaction?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!