1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aniked [119]
3 years ago
9

Animales que producen su propio alimento

Biology
2 answers:
Lilit [14]3 years ago
7 0
While animals can’t make their own food, insects like ants or termites can make their own food. Bees are also an example of this
Veseljchak [2.6K]3 years ago
4 0

Answer:

El pez que cultiva algas.

El cangrejo bailarín.

Explanation:

You might be interested in
An illustration of a cell interacting with its environment is provided.
Natalka [10]
The answer is B brooski
6 0
3 years ago
Read 2 more answers
The ovaries are part of the endocrine system. TRUE or FALSE.
Arada [10]
The ovaries are a part of the endocrine system, so its true.
3 0
3 years ago
What measures did people take to prepare for the storms?
Anika [276]

The most important thing to prepare for a storm is knowing were to go in case you need to evacuate. If the later is not a possibility then create and practice a plan of action for you and your family and build and emergency kit with first-aid supplies, water and nonperishable foods. After that you can focus on identifying the safest place in your house, establish an emergency communication channel with your family and reinforce the roof, windows and doors. <span>Secure the heavy furniture to avoid accidents and move it away from door and windows and keep tuned to your local radio station to know how to expect at every time.</span>

8 0
3 years ago
~will give brainliest + 15pts
Komok [63]

Answer:

D

Explanation:

7 0
3 years ago
Read 2 more answers
1. The plant life that is characteristic of a biome depends upon:
eimsori [14]

Answer:

D. all of the above​

Explanation:

Biome refers to a large and relatively distinct terrestrial region having similar climatic conditions regardless of where it occurs on Earth. The characteristic climatic conditions (temperature and precipitation being the most important ones) and soil type of each biome type determine the type of plant species found there. Therefore, each biome is characterized by specific flora.  

For example, a desert biome is a temperate or tropical biome characterized by a lack of precipitation, seasonal variations in temperature and poor soil type with low organic matter that limits plant growth. Desert biomes have only the plant species that can survive these harsh conditions.  

5 0
3 years ago
Other questions:
  • Which of these accurately describes the process of translation?
    7·1 answer
  • Circulatory systems compensate for _____.
    7·1 answer
  • Sexual reproduction is important to the survival of a species in a changing environment because
    8·1 answer
  • If the gametes produced by a given organism contain 6 chromosomes, how many chromosomes are found in that organism's body cells?
    8·1 answer
  • What are two basic differences between DNA and RNA?
    6·2 answers
  • Which curve show an equal chance of dying regardless of age
    11·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Bicoid mRNA is expressed in a gradient in Drosophila embryos. Loss of Bicoid function leads to embryos with two posterior ends.
    9·1 answer
  • Dynamic stretches are part of an effective warm-up because they can help...
    13·2 answers
  • Which of the following organelles uses carbon dioxide to produce sugars (glucose)?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!