Explanation:
Amylase, lipase, pepsin, trypsin
Help in digestion of food by catabolizing nutrients into monomeric units
Hemoglobin, albumin
Carry substances in the blood or lymph throughout the body
Actin, tubulin, keratin
Construct different structures, like the cytoskeleton
Insulin, thyroxine
Coordinate the activity of different body systems
Legume storage proteins, egg white (albumin) Provide nourishment in early development of the embryo and the seedling
How to balance an iduviguals rights with meeting the needs of socity
In the Hardy-Weinberg principle, the values of p and q will not change if evolution is not occurring.
<h3>What is the Hardy-Weinberg principle?</h3>
The Hardy-Weinberg principle is a model used in population genetics to estimate genotypic and allele frequencies in a population.
The Hardy-Weinberg principle states that allele and genotypic frequencies remain constant in absence of evolutionary forces.
These evolutionary forces include nonrandom mating, gene drift, gene flow, mutation and natural selection.
Learn more about the Hardy-Weinberg principle here:
brainly.com/question/3406634
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
If air in a pump is squeezed more, then the air gets hotter because energy is added to it.
Explanation:
A good hypothesis in the given case is that inflating basketball is getting warmer, the more it is pumped, and as a result, it would possess more heat or more friction due to all the air being pumped into the basketball at a single time.
hope this helped!
