1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
12345 [234]
3 years ago
5

Fossil fuels are part of which biochemical cycle ?

Biology
1 answer:
inessss [21]3 years ago
4 0
It is part of the CARBON CYCLE
You might be interested in
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Which is currently the most supported theory about the future of the universe?
Papessa [141]

Answer:

B. The Universe may continue to expand

Explanation:

6 0
4 years ago
Which of the following statements about the mechanisms of postural control is FALSE?A. Sensory mechanisms are used to detect and
Goshia [24]

Answer:

.E. All of the preceding statements are TRUE.

Explanation:

It's not mechanism

5 0
3 years ago
What happens to the temperature when the atmospheric co2 level increases in this model?
lions [1.4K]

Answer:

The temperature of the surrounding air increases when the atmospheric CO2 level increases.

Explanation:

Carbondioxide gas is also called greenhouse gas because it has the ability to absorb or trap heat energy when the solar radiation goes into the space after hitting the earth surface. If the concentration of carbondioxide gas is increased, more heat energy will be trapped and thus increase occurs in the temperature of the atmosphere which results in global warming.

5 0
3 years ago
I need helpppp ASAPPP
Margaret [11]

I think the answer is "It's tightly packed cells allow for protection against harmful substances."

6 0
3 years ago
Other questions:
  • Biochemical changes in the body, that affect the rate of metabolism and elimination of a substance from the body and produce inc
    12·1 answer
  • An amino acid is synthesized by the prokaryote, E. coli. The genes for the enzymes are responsible for synthesizing this amino a
    10·1 answer
  • This is the reproductive part of the plant and it produces seeds and develops the fruit.
    8·1 answer
  • Define hypothesis and give an example of one.
    11·1 answer
  • The rate of species extinction on Earth is currently very high—perhaps as high as it has been since the time of the dinosaur ext
    11·2 answers
  • Which part of the cell membrane can catalyze chemical reactions
    14·2 answers
  • Define Heat, Thermal Energy, Conduction, Convection and Radiation
    13·1 answer
  • Subject: Integrated Science Question
    13·1 answer
  • Evolution is a gradual process true or false
    5·1 answer
  • Charles Boyle was a scientist who studied the relationship between the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!