1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
3 years ago
10

Maintaining homeostasis keeps the internal environment in the body functioning properly. Many organ systems work together and ma

intain energy homeostasis. The digestive system is concerned with processing the food that we take in to provide essential nutrients to the rest of the body. Which of these body systems works most directly with the digestive system in the absorption of nutrients?
A) urinary system
B) endocrine system
C) respiratory system
D) cardiovascular system

Biology
1 answer:
Varvara68 [4.7K]3 years ago
4 0

Answer:

D

Explanation:

However, the organ systems also work together to help the body maintain homeostasis. For example, the cardiovascular, urinary, and lymphatic systems all help the body control water balance. The cardiovascular and lymphatic systems transport fluids throughout the body and help sense both solute and water levels and regulate pressure.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What do you call a person who studies plants and animals?
Gekata [30.6K]
A biologist whose interest lies primarily in the study of plants or animals can be called a naturalist, although these days it's more likely she'll be called a natural historian, a botanist, or a zoologist.
6 0
3 years ago
What is structure g called?
REY [17]
Structure g is called the lysosome
4 0
3 years ago
10. A fish is characterized by the presence of
egoroff_w [7]

Answer:

d

Explanation:

Fishes are aquatic vertebrates having scales, pharyngeal gill slits and paired fins. ... Most fish are ectothermic ("cold-blooded"), allowing their body temperatures to vary as ambient temperatures change. fishes have scales that covers the skin of fishes. Thus, the correct answer is option D.

3 0
3 years ago
Read 2 more answers
Do saturated fats have single carbon-to-carbon bonds or at least one double carbon-to-carbon bond?
Sladkaya [172]

Answer:

Saturated fats contain only single carbon bonds in the carbon chain

Explanation:

6 0
4 years ago
Other questions:
  • The hydrogen atom of one water molecule bonds with the oxygen atom of another water molecule. What is this bond referred to as?
    13·1 answer
  • A woman at 41 weeks' gestation is progressing well in labor; however, the nurse notes the amniotic fluid is greenish in color. w
    10·1 answer
  • Of the chemicals that fall under the tsca ________% have been tested for toxicity and ________ have been tested for endocrine, n
    10·1 answer
  • Ron is running an experiment to see if certain sounds can improve memory. While testing the subjects’ memory, Ron unintentionall
    5·1 answer
  • Which steo in not a part if a normal convection cycle?
    11·2 answers
  • The process in which body cells are duplicated in order to grow and repair body tissue is called what
    9·2 answers
  • What are you enzymes made from
    10·2 answers
  • Determine which DNA technology allows for each of the following scenarios
    12·2 answers
  • The outermost part of the brain, made up of tightly packed neurons and only a tenth of an inch thick, is called the __________.
    14·1 answer
  • How does the structure of xylem relate to its function
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!