1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BlackZzzverrR [31]
2 years ago
13

witness testifies in front of the jury that he saw the defendant enter the convenience store about one minute before he heard gu

n shots. What type of evidence is this?
Law
1 answer:
fredd [130]2 years ago
3 0

Answer:

Testimonial evidence

Explanation:

Testimonial evidence is evidence provided by people who were in the vicinity of the area where the case was located, and who, under oath, assure that they saw or heard something related to the case.

In the question, we have a typical example of testimonial evidence because a witness is assuring that he saw the defendant in the area that is related to the case, but is not necessarily providing any other type of evidence to support that claim. Whether the testimony is considered truthful or not, or relevant or not, depends on the context of the case, and on the ultimate decision of the jury.

You might be interested in
Select the correct answer from each drop-down menu.
olya-2409 [2.1K]

Answer:

<u>Limited governments</u> have legal restrictions imposed on their powers. Examples of these governments include the United Kingdom and <u>Germany.</u> The citizens of these countries enjoy <u>basic</u> rights such as freedom of speech and the press. However, <u>unconfined governments</u> don’t face any legal restrictions on their powers. As a result, the citizens of these governments often experience human rights violations.

6 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
Who is the most important person in the court room during a trial?
nydimaria [60]

Answer:

Prosecutor

Explanation:

4 0
3 years ago
Read 2 more answers
Heifer international's function is to help reduce poverty by providing
dexar [7]

Answer: free food from livestock raised by Heifer International

Explanation:

3 0
2 years ago
The condemnation of property is not an involuntary conversion, since it is done pursuant to a government decree. True False​
Rudiy27

Answer: False.

Explanation:

3 0
1 year ago
Other questions:
  • What was the purpose of the Constitution Convention in 1787?
    9·1 answer
  • Which complaint was the greatest barrier to ratifying the Constitution? A. It did not include the bill of rights B. It had to be
    9·2 answers
  • What level of government gets most of its revenue from income tax?
    5·1 answer
  • What was the central issue in the Case of Marbury v. Madison?
    6·1 answer
  • Some Police Officer have issues with ethics and entitlement when they are doing the wrong thing.
    11·1 answer
  • PLEASE I ONLY HAVE 7 MINUTES LEFT
    14·1 answer
  • Why is the Bill of Rights still controversial today?
    5·2 answers
  • Making school punishment more uniform through the zero tolerance policy was intended to:
    15·1 answer
  • True or False. During the 1980s and 1990s and the "get-tough” movement,
    10·1 answer
  • QUESTION 7
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!