1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetoff [14.1K]
2 years ago
8

Cancer is not usually inherited because Cancer is not usually inherited because the cancerous cells usually interfere with the a

bility to produce gametes. the chromosomal changes in cancer are usually confined to somatic cells. people with cancer usually die before reproducing. the causes of cancer are not usually genetic.
Biology
1 answer:
kkurt [141]2 years ago
3 0
But the DNA in the woman's eggs is still perfectly normal. So she won't pass on her lung cancer to her kids. This is why cancer is so rarely inherited. Since cancer often happens because of a DNA accident in a cell other than an egg or a sperm, it is not passed down
You might be interested in
Is Vanilla Silk Milk?
bearhunter [10]

Answer:

Yes it is milk.

Explanation:

The main component would be the milk, the other 2 would be silk and vanilla to create the substance! Since vanilla is a main component !! It can be classified as milk !!

6 0
3 years ago
Read 2 more answers
Is it possible to find the same gene in two different kinds of organisms but not find the protein that is produced from that gen
Deffense [45]

Answer:

Yes

Explanation:

This is made possible by latent genes, or genes in an unexpressed state.

6 0
2 years ago
Forces on an object are combined to determine the ________ on that object
aivan3 [116]
Forces on an object are combined yo determine the net force on that object.

if two forces are acting on a object in the same object the net force is the sum of both of them

if two forces are acting on an object in different directions they are subtracted

in the photo above the net force is 3

3 0
3 years ago
American cars use about 600 000 000 gallons of oil per year. How many liters of oil do American cars use per year? Report your a
miv72 [106K]
24 x 10 to the 8th power. Sorry I don't know how to do the exponents on here
6 0
3 years ago
Read 2 more answers
The simplest structured unit of a compound is a(n):<br> electron<br> atom<br> proton<br> molecule
tiny-mole [99]
The answer is molecule
8 0
3 years ago
Read 2 more answers
Other questions:
  • Often when a family member is dying, the client and the family are at different stages of grieving. during which stage of a clie
    6·1 answer
  • 1. Whats a difference and a similarity between<br> the Water Cycle &amp; Carbon Cycle?
    10·1 answer
  • An activity that occurs in the human body is shown below.
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • True or False: Within the body, all atoms combine to form molecules. If false, why?
    8·1 answer
  • What main idea about the nature of the cell did historical scientists disagree on?
    5·1 answer
  • What type of reproduction does not involve a male and female cell?
    5·2 answers
  • Imagine a population of moths. White moths are easier for birds to see and eat. Black moths blend into their surroundings, so th
    15·1 answer
  • Why are some theories more widely accepted than others such as the theory of evolution?
    10·1 answer
  • Explain how different TYPES OF ORGANISMS defend themselves against microorganisms. (6 marks)
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!