1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ziro4ka [17]
3 years ago
5

The orderly changes that an organism goes through as it grows into an adult are known as the organism's

Biology
1 answer:
Zinaida [17]3 years ago
3 0

Answer:

D. life cycle

Explanation:

A life cycle describes the stages and orderly changes an organism goes through from the beginning of its life to an adult capable of reproducing.

You might be interested in
What are the species that no longer exist on Earth known as?
eduard

D. extinct

Explanation:

they fall under the category of “extinct”

6 0
3 years ago
Which of the following are photosynthetic autotrophs?
Semenov [28]
Hello, Tristanfranzino!

Plants are photosynthetic autotroph.

An autotroph is an organism who makes their own food. Plants do that.
Plants are also photosynthetic, which means they use photosynthesis.

Answer: Plants

Hope this helps :)
3 0
4 years ago
Read 2 more answers
The salivary glands start the process of digestion.<br><br> True False
Ratling [72]
Yes the answer is true it is the start of the digestion process.+

8 0
4 years ago
Read 2 more answers
Several factors influence the rate of diffusion and among these factors are temperature, ____________ , electrical currents, and
katrin2010 [14]

Answer: States of matter; increases

Several factors influence the rate of diffusion and among these factors are temperature, STATES OF MATTER, electrical currents, and molecular size. For example, as temperature INCREASES, the rate of diffusion increases.

Explanation:

Factors influencing the rate of diffusion include:

- Temperature: High temperature increases the speed at which molecules move. Thus, as temperature increases, the rate of diffusion increases

- States of matter: Diffusion varies within the three states of matter. The diffusion of gases is much faster than that of liquids and solids, because the gas molecules are freer and therefore faster than the rest.

- Molecular size: The smaller the molecules, the faster the rate of diffusion while the larger the molecules, the slower the rate of diffusion.

Other factors include electrical currents.

8 0
3 years ago
Why did Mendel use pure lines in his experiment? A.Pure lines grew faster. B.He needed a control group. C.He had no other plants
Umnica [9.8K]
B. He needed group control.

Hope this helped!!!
6 0
3 years ago
Read 2 more answers
Other questions:
  • What do aerobic reputation and anaerobic respiration have in common
    8·1 answer
  • How do the six kingdoms fit into the three domains?
    6·1 answer
  • What influences the appearance and function of skeletal muscle?
    12·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • The Paleozoic Era is the longest time period in the history of Earth.
    9·2 answers
  • Both vegetable oil and butter are made up of fats.
    5·1 answer
  • Alice has type A blood and her husband mark has type B blood. Their first child, Amanda, has type O blood. Their second child ha
    8·1 answer
  • Help in the science pls (my gramm3er is dead)
    7·1 answer
  • Which of the following correctly orders events during mitosis?
    8·2 answers
  • The light source of a dissecting microscope comes from _________, while the light source of a compound microscope comes from ___
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!