1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lostsunrise [7]
3 years ago
9

Describe two ways the biosphere interacts with the atmosphere.​

Biology
1 answer:
Mashcka [7]3 years ago
3 0

Answer:

In more subtle ways, atmosphere-biosphere interactions influence the health of the air we breathe (see figure): rough surfaces of vegetation remove aerosols, ozone, and other reactive gases from the air through dry deposition; plants emit a huge variety of volatile organic compounds (VOCs) that are precursors to ..

You might be interested in
Describe the feature of cell mbrane​
ahrayia [7]

Answer:

The cell membrane or plasma membrane is a biological and thin semi-permeable membrane that surrounds the cytoplasm of a cell

Explanation:

8 0
3 years ago
Helium does not usually react with other substances. Does this mean that helium has no chemical properties?
Anettt [7]

Helium does not react with any other substances, thus the substance’s internal structure is never greatly affected and thus helium cannot have any chemical properties.

6 0
3 years ago
Aiding in emotional processing and arousal functions are functions of the __________. A. Thalamus B. Hypothalamus C. Cerebrum D.
Liono4ka [1.6K]

Answer:

A. Thalamus

Explanation:

There are two large ovoid organs called the thalamus, which form most of the lateral walls of the third ventricle of the brain. A variety of receptors transmit signals from the thalamus to the cerebral cortex. Thalamus is anatomically situated adjacent to the midline third ventricle in the brain.

5 0
2 years ago
Two Difference between radicle and plumule<br>​
Butoxors [25]

Answer:

radical forms root , plumule forms shoot

6 0
2 years ago
Read 2 more answers
Which type how many chromosomes are in a normal human karyotype?
Bumek [7]
Each human cell contains 46 chromosomes.
5 0
3 years ago
Read 2 more answers
Other questions:
  • What is a amino group
    10·1 answer
  • When the temperature of the environment changes, what dose the body temperature of a reptile do
    7·1 answer
  • Hey guys this is my biology and can you guys help out here's the question and answers
    5·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In the picture above, which fossils do you think would be the oldest? Which would be the youngest? Why?
    11·1 answer
  • In multicellular organisms, many cells perform specific jobs that other cells do not, which allows
    5·1 answer
  • Florida orange growers often have hundreds of trees in their orchard, similar to those shown here. Florida temperatures can be
    12·1 answer
  • What type of cell division is b​
    13·1 answer
  • 4. Owls have large eyes that enable it to see well at night. Both the hawk and the owl hunt similar things: small rodents or sna
    8·1 answer
  • Explain why it would not be possible to accurately measure hemoglobin concentration if the RBCs were not first lysed
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!