1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paha777 [63]
2 years ago
8

Sometimes a population cannot grow to its biotic potential due to environmental conditions called ____________.

Biology
2 answers:
strojnjashka [21]2 years ago
8 0
C because limiting factor can’t grow to it’s biotic!





DENIUS [597]2 years ago
7 0
C because of those environmental conditions this answer would be the word used in that sentence when you look at it it makes more sense that the rest especially the definition of the word
You might be interested in
What causes earthquakes and at what types of plate boundaries are earthquakes common? Explain.
sashaice [31]
Transform plate boundaries because when two plate boundaries slide past each other, they create vibrations. A large amount of those vibrations are earthquakes
3 0
3 years ago
If your blood becomes too concentrated with ions, what will happen to the red blood cells?
Leto [7]
When red blood cells are in a higher concentrated solution, water flows out of the cells faster than it comes in. This results in crenation or shrivelling of the cell.
6 0
3 years ago
Which hypothesis is false?
juin [17]

Answer:

#2

Explanation:

I don't really think either of them are false though. They're both technically accurate but I believe it's #2

8 0
2 years ago
RNAis a single stranded molecule unlike the double stranded DNA and replaces
user100 [1]
Yes. RNA is single stranded
8 0
3 years ago
What is "A C G G A T C G" as an mRNA strand?
rodikova [14]
UGCCUAGC i think m not fully sure
7 0
3 years ago
Other questions:
  • Compare and contrast photosynthesis and respiration.
    10·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Recessive genes are expressed under which of the following conditions?
    9·1 answer
  • True or false? all foods that have been irradiated are required to be labeled as such.
    15·1 answer
  • Which stage of MITOSIS is shown in the picture above?
    7·1 answer
  • What is the normal white blood cell count?
    12·1 answer
  • What is a change that improves a species' chance of survival?
    6·2 answers
  • If there are 12 chromosomes in an animal cell in the G 1 stage of the cell cycle, what is the diploid number of chromosomes for
    7·1 answer
  • What tool does CMS require that skilled nursing facilities use to collect and to report clinical data on residents?
    6·1 answer
  • 1.3. Why is it important to prioritise your life goals?​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!