1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paraphin [41]
2 years ago
15

Diagram of breasts...​

Biology
1 answer:
Mumz [18]2 years ago
3 0

Answer:

diagram of breasts

Explanation:

You might be interested in
I’ll mark as BRANLIEST!!
malfutka [58]

‎

‎‎‎‎‎‎‎ ‎

‎‎‎‎‎‎‎ ‎

‎‎‎‎‎‎‎ ‎

‎‎‎‎‎‎‎ ‎

‎‎‎‎‎‎‎

7 0
2 years ago
Read 2 more answers
This is an organic compound consisting entirely of hydrogen and carbon
andreyandreev [35.5K]

the answer is... hydrocarbons

8 0
3 years ago
A major volcanic belt known as the ______ circles the Pacific Ocean.
mr Goodwill [35]
<span>A major volcanic belt known as the ring of fire circles the Pacific Ocean. The Pacific Ring of Fire </span><span>is an area where a large number of earthquakes and volcanic eruptions occur in the basin of the </span>Pacific<span> Ocean.</span>
3 0
3 years ago
What happens in the process of transcription
dolphi86 [110]
During the process of transcription, a portion of a DNA molecule is used to create a mRNA Molecule. DNA stores genetic information in the nucleus of your cells. When RNA molecules are produced it happens inside the nucleus. The RNA molecule can then leave the nucleus and travel to ribosomes which are located in the cytoplasm and attached to endoplasmic reticulum. The RNA will be used to create proteins molecules.
8 0
3 years ago
Please help I’m not sure
Anna71 [15]

Answer:

A: a giraffe’s long neck

Explanation:

6 0
2 years ago
Read 2 more answers
Other questions:
  • What are the advantages of having two chromogens cells an one? The full form of DNA.
    10·1 answer
  • An organism that carries two unique genes (alleles) for a trait is called a/an _____________.
    11·1 answer
  • The Virginia Coastal Zone Management Program was approved by NOAA in 1986 and its goals include protecting coastal resources, ai
    8·2 answers
  • What structure is formed during the unwinding process of replication
    5·2 answers
  • PLEASE ANSWER ASAP! WILL MARK BEST ANSWER AS BRAINLIEST!!!
    11·1 answer
  • What is usually the origin of a non-standard amino acid residue found in a polypeptide chain?
    15·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Category Agriculture Deforestation Waste Materials Use of Plastics Urbanization Fossil Fuel Usage Population Growth Add your own
    12·1 answer
  • If smooth endoplasmic reticulum is damaged in liver cells, what happens?
    15·1 answer
  • True or false: A cell's DNA is replicated during the M phase of the cell cycle.​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!