1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pepsi [2]
2 years ago
15

Hownis the total magnification of a cell calculated

Biology
1 answer:
lys-0071 [83]2 years ago
7 0

Answer:

The total magnification of a cell is calculated by multiplying the magnification of the ocular lens (also known as eyepiece lens) and the objective lens.

You might be interested in
Hi, I need a cheat sheet for a test (benchmark) about advanced weather topics (air pressure, radiation, conduction, convection,
boyakko [2]

Answer:

here:

Explanation:

Hope this helps! Brainliest would be much appreciated! Have a great day! :)

5 0
2 years ago
How many outer atoms and lone pairs are present in a molecule with a see-saw shape?
Gnom [1K]
There are 4 outer atoms and lone pairs that are present in a molecule with a see-saw shape. It was called "seesaw" comes from the observation that it looks like a playground seesaw. It is very common that four bonds to a central atom result in tetrahedral or, less commonly, square planar geometry. 
5 0
3 years ago
Launch the concept map by clicking the button below. read the instructions that appear on the new screen. drag the terms and phr
Licemer1 [7]
Commenting only to the small part of the terms it seems you had for the concept map...
Amino acids are the base of proteins. They are organic compounds with an amine group and a carboxyl group.
Carbohydrates are polymers of monosaccharides, or simple sugars.
6 0
3 years ago
Read 2 more answers
As compared to developing countries, developed countries have a
kherson [118]
I would say C! Most developing countries have high birth and death rates, while developed countries are more steady.
7 0
3 years ago
What is the difference between an epidemic and a pandemic?
Vilka [71]

Answer:

Pandemic is related to disease and epidemic isn't

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What are areas of dna that are not needed to produce a protein called?
    11·1 answer
  • What is the term for the junction between one nerve cell and the next called?
    5·1 answer
  • Some organisms in the ecosystem obtain energy and nutrients from plants these organisms stores the energy in their bodies what h
    5·1 answer
  • In which kingdoms are all organisms multicellular?
    12·2 answers
  • Durring the process of the genetic message from dna is transformed into mrna
    15·1 answer
  • A vein in a leaf has what important function?
    6·1 answer
  • Can someone answer these 3 questions for me please???
    8·1 answer
  • Which statement about mitosis is true? (brainliest)(15points)
    8·2 answers
  • How do spores help the survival of spore-bearing plant?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!