1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxTIMURxx [149]
3 years ago
13

The Chatham Island robin is a small endangered bird found in scrub forests off the coast of New Zealand. The robin is preyed upo

n by introduced species such as cats and rats. In 1980, the population decreased to only 5 individuals and every individual today is a descendant of a single female. Which of the following is best illustrated in the decline of the Chatham Island robins?
1. Carrying capacity
2. Population bottleneck
3, Population overshoot
4. Type I survivorship
Biology
1 answer:
vova2212 [387]3 years ago
7 0

Answer: 2. Population bottleneck

Explanation:

A Population bottleneck is a term used to refer to an event that causes the population of a species to reduce in very large numbers. Such an event can be environmental disasters like famine, the overhunting of a species or the destruction of its habitat.

In the case of the Cha-tham Island Robin, the bottleneck event must have been the introduction of cats and rats which then went on to hunt the birds to near extinction.

You might be interested in
Which of the following would describe Lamarques ideas about evolution
victus00 [196]

new inventions such as machines

7 0
3 years ago
Students observed that when they played violent video games, they experienced an increase in heart rate. One student group condu
Vera_Pavlovna [14]

Answer:

the first question answer is C and for the second one is D

7 0
3 years ago
Read 2 more answers
Which 2 organs perform both chemical and mechanical digestion?
r-ruslan [8.4K]

Answer:

Mouth and stomach.

Explanation:

4 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What will happen if an appropriate enzyme is added to chemical reaction
slava [35]
The enzyme will work as a catalyst and make the chemical reaction happen quicker
6 0
3 years ago
Other questions:
  • Principle that states that the inheritance of a gene for one trait does not affect the inheritance of the gene for a different t
    9·1 answer
  • Why are Daphnia good model organisms in biology?
    5·1 answer
  • The Quiver tree grows in Southern Africa. Which of the following plant adaptations is likely to prevent these trees from dying o
    7·1 answer
  • How is the male reproductive system different from other body systems?
    13·2 answers
  • An alarm clock ringing is an example of a:
    13·1 answer
  • Which organ produces estrogen and progesterone?
    15·2 answers
  • What is phosphoglucomutase
    7·1 answer
  • 6CO2 + 6H2O + LIGHT ENERGY, C6H120g is the equation for
    12·1 answer
  • What effect did the zebra mussels have on the phytoplankton in the Hudson River ?
    9·1 answer
  • Is used in all steps of protein synthesis and carries the genetic information of many viruses.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!