1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mestny [16]
2 years ago
14

After phagocytosis occurs, enzymes from which organelle can digest what is in the vesicle/vacuole?

Biology
1 answer:
mezya [45]2 years ago
8 0

Answer: Phagocytosis and Autophagy

Such large particles are taken up in phagocytic vacuoles (phagosomes), which then fuse with lysosomes, resulting in digestion of their contents.

Explanation: That's what I would say. Hope this helped and i hope you have a beautiful day:]

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Missy spencer was given penicillin for tonsillitis. she developed a severe life-threatening allergic (hypersensitivity) reaction
KatRina [158]

The reaction of which Missy has experience that is a severe and life threatening allergic reaction due to penicillin is anaphylactic reaction, it could be classified as the a serious and life threatening in terms of having allergic reaction for if not treated immediately, it could cause death to the individual who has experience this reaction. This could be triggered from either medications, food in which an individual has consumed and insect stings such as from bees. Missy’s allergic reaction must have triggered because of the penicillin that she has consumed where in, she does not know that she is allergic to the medication, having her to experience a life threatening allergic reaction to the penicillin.

5 0
3 years ago
AZT is a reverse transcriptase inhibitor. How does this drug prevent the replication of a retrovirus
Artemon [7]

Answer:

AZT is a thymidine analog

Explanation:

Azidothymidine (AZT) is an antiviral drug used for the treatment of the Human immunodeficiency virus infection (HIV/AIDS) by preventing the transmission of HIV from infected cells. AZT is capable of suppressing the activity of the enzyme reverse transcriptase of the retroviral HIV genome, which enables it to copy RNA into DNA. In infected cells, this double-stranded DNA is integrated into the host genome which is then instructed to produce identical HIV copies. AZT is a thymidine analog that is incorporated into DNA and thus interferes with DNA synthesis, thereby inhibiting cell proliferation.

4 0
3 years ago
Choose 3 of your favorite animals from the Lion King and research their binomial nomenclature (scientific name) and one symbioti
qwelly [4]

Answer:

Simba , Scar and MUfasa

Explanation:

BEST ONES YET

6 0
3 years ago
What time of day would you expect to see a First Quarter moonrise?
mel-nik [20]
I think the answer would be mid-noon.
4 0
3 years ago
Read 2 more answers
Other questions:
  • anaerobic respiration converts glucose into energy and by-products like ethanol carbon dioxide or lactic acid this is possible b
    8·1 answer
  • What happens to the most of the energy stored in glucose in anaerboic respiration?
    7·1 answer
  • Ayudaaaaa porfavor!!!
    10·1 answer
  • Since prokaryotic cells lack membrane bound organelles, many metabolic functions in the cell take place...
    5·2 answers
  • Scientists believe that Earth and the other planets formed _____.
    10·2 answers
  • According to the data in model 1, how many males are 181 cm or above in height
    6·1 answer
  • The original DNA gene for a certain protein reads “TTC CAT GGG GAC." The mutated version of this gene reads “TTC CGT GGG GAC." T
    13·2 answers
  • Digest the plants to obtain their energy is called
    8·1 answer
  • Which human activity would most likely decrease the amount of carbon in the atmosphere?clearing forestsheating coalburning woodp
    10·2 answers
  • Evidence of which structure or characteristic would be most surprising to find among fossils of the ediacaran fauna?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!