1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leva [86]
3 years ago
14

HELP !!

Biology
2 answers:
Snowcat [4.5K]3 years ago
8 0

A. Carbon

Explanation:

because during photosynthesis, the cells use carbon dioxide and the light from the sun and that makes sugar molecules.

Andreas93 [3]3 years ago
7 0
Actually non of the options
Because the plants during photosynthesis use carbon, sunlight, and water in order to produce oxygen & sugar (specifically glucose)
You might be interested in
Classify each description as true of introns only, exons only, or both.A-present in eukaryotic genomesB-generally absent from ba
maxonik [38]

The right answers are:

A-present in eukaryotic genomes ==> Both exons and introns

B-generally absent from bacterial genomes ==> Introns

C-part of the final mRNA strand ==> Exons

D-code for an amino acid sequence ==> Exons

E-removed from initial mRNA strand prior to translation ==> Introns

F-present in the DNA used as the template for transcription ==> Both exons and introns

In the genes of eukaryotic organisms, the exons are the segments of an RNA precursor that are conserved in the RNA after splicing and that are found in mature RNA in the cytoplasm. The segments of the RNA precursor that are removed during splicing are called in opposition to introns. Exons are mainly found in messenger RNAs (mRNAs) encoding proteins. Some mRNAs may sometimes undergo an alternative splicing process in which one or more exons may be excised or some introns preserved in rare cases.

6 0
3 years ago
Secondary endosymbiosis led to chloroplasts surrounded by two membranes.
Anna35 [415]
Answer: False
Hope this helps b
6 0
2 years ago
What does an inhibitor do ?
OLEGan [10]

Answer:

Enzyme inhibitors are molecules or compounds that bind to enzymes and result in a decrease in their activity. An inhibitor can bind to an enzyme and stop a substrate from entering the enzyme's active site and/or prevent the enzyme from catalyzing a chemical reaction. There are two categories of inhibitors.

Explanation:

I had to look this up lol. hope it helps tho!

7 0
3 years ago
One g of fecal matter was suspended in 99 ml saline solution (tube 1). After mixing gently but thoroughly, one ml from tube 1 wa
malfutka [58]

Answer: the cfu/g Gram-negative bacteria in the fecal sample is C = 3.0 × 10^3

Explanation:

We know that; Gram negative bacteria looks  pale reddish in color under a light microscope from Gram staining.

therefore

There are 30 red bacterial colonies counted.

1 mL of from tube 1 was removed and added to tube with 99 mL saline (tube 2) dilution is 1/100.

transferred volume  into the plate is 1 mL.

Now, we have to determine the cfu/g Gram-negative bacteria in the fecal sample

Formula to calculate CFU/g bacteria in fecal sample is expressed as;

C = n/(s×d )

where C is concentration (CFU/g) , n is number of colonies , s is volume transferred to plate , d is dilution factor.

so we substitute

C = 30 / ((1/100) × 1)

C = 30 / 0.01

C = 3000

C = 3.0 × 10^3

THERFERE, the cfu/g Gram-negative bacteria in the fecal sample is C = 3.0 × 10^3

3 0
4 years ago
A plant can have green (G) or yellow (g) leaves. It can also have a long (K) or
vesna_86 [32]
Here ya go hoope this helps

6 0
3 years ago
Other questions:
  • Mercury has a density of 13.5 g/cm^3. What would an object's density have to be for it to sink in mercury?
    7·1 answer
  • Complete the following rule if a child is different from both of their parents, the child must be
    13·2 answers
  • The exchange of segments of dna between the members of a pair of chromosomes is called:
    8·1 answer
  • Would you say glucose or sucrose is more complex why
    5·1 answer
  • Which statement is true about cellular respiration and photosynthesis
    9·1 answer
  • Cell structure and transport study guide
    14·1 answer
  • How does water effect metamorphic process
    7·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Help me please!! <br> I’ll brainliest u if u get it right!
    13·1 answer
  • PLEASE HELP! - Describe why carbon, hydrogen, oxygen, nitrogen, &amp; other elements can combine. Describe the results of these
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!