1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marat540 [252]
3 years ago
9

Mass will increase as…

Biology
1 answer:
Papessa [141]3 years ago
7 0

Answer:

a) number of particles increases

Explanation:

hope this helps

You might be interested in
Cs2 es polar o no polar?
kramer

Answer:

CS2 no es polar debido a la forma lineal simétrica de los átomos. English: it is not polar.

Explanation:

3 0
3 years ago
Una persona hala un trineo a lo largo de un espacio horizontal de 9 m la cuerda con que sa hala forma un ángulo de 60° con la ho
polet [3.4K]

Answer:

978,75 Newton metro.

Explicación:

El trabajo realizado es de 978,75 Newton metro cuando la fuerza es de 125 newton, la distancia es de 9 metros y el ángulo es de 60 grados porque cuando usamos la fórmula del trabajo realizado obtenemos esta respuesta. La fórmula del trabajo es fuerza x desplazamiento x Sin (θ). θ muestra la dirección y el ángulo en el que se realiza la fuerza. Entonces, multiplicando todos estos valores obtenemos la respuesta para el trabajo realizado, que es 978,75 Newton metro.

5 0
3 years ago
In human beings, the statistical probability of getting either a male or female child is 50:50. Give a suitable explanation.​
suter [353]

Answer:

There is 50 chance because there are two chromosomes that are same and two which are difeerent . XX MEANs girl XY means boys .

3 0
3 years ago
Read 2 more answers
Complex organisms produce sex cells that unite during fertilization
Mekhanik [1.2K]

Answer:

D

Explanation:

I took the test

3 0
3 years ago
Read 2 more answers
Offer a hypothesis to explain why humans have undergone near-exponential growth for over 500 years.
amm1812

Creative Diagnostics offers highly uniform Silver Nanoparticles widely used in biology and medicine. https://www.cd-bioparticles.com/product/silver-nanoparticles-list-166.html

8 0
3 years ago
Other questions:
  • PLEASE HELP! what are environmental parameters that should be examined before building on land?
    6·1 answer
  • A group of students are walking in the park, and one of them takes a picture of a pollen grain that is being blown by the wind.
    8·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • If m || n and the slope of the line m is 3, what is the slope of line n?
    7·1 answer
  • After strenuous exercise sore muscles can occur because of?
    9·1 answer
  • How does air pressure in a rocket work
    10·1 answer
  • Electron Microscopes can see cells and cell structures as small as
    13·1 answer
  • Which statement correctly describes a difference between asexual and sexual reproduction?
    9·1 answer
  • Millipedes are.
    7·2 answers
  • What iS one reason scientists have a developed a system to classify organisms?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!