1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

Fill in the blank below with the vocabulary word that best completes the sentence.

Biology
2 answers:
love history [14]3 years ago
8 1

Answer:

natural growth

Explanation:

because all thing's which are natural are natural resources.

SCORPION-xisa [38]3 years ago
4 0

Answer:

Fill in the blank below with the word that best completes the sentence.

Natural selection leads to Evolution, a process of change in a population over time.

after

Complete the sentence below by selecting the correct words from the drop-down menus.

Factors that affect natural selection include

✔ variation

,

✔ overpopulation

, and

✔ adaptation

.

Explanation:

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Distance measurements based on the speed of light; used for objects in space<br><br> need help!!!
LiRa [457]
As already said, light years is the correct answer, give other peep brainiest 
3 0
3 years ago
Read 2 more answers
Which of the following statements about chemiosmosis is NOT true?
melomori [17]

Answer:

I don't know the answer to the first one, but I can answer the second question. <em>Cellular respiration </em><u><em>has carbon dioxide and water as waste products</em></u><em>.</em>

Explanation:

<em>Cellular respiration</em> does <u>not</u> form glucose & oxygen and doesn't occur in the chloroplast, but does form <em>ATP energy</em>, <em>carbon dioxide</em>, & <em>water</em> and the process occurs in <em>mitochondria</em>. Photosynthesis on the other hand forms glucose & oxygen and does occur in the chloroplast.

7 0
3 years ago
In a normal body cell of a dogfish shark, there are 24 chromosomes. how many chromosomes are found in each of its gametes
vovikov84 [41]
The answer is:  "12 (twelve)" .
_____________________________________
 Note:  24 / 2  = 12 .
______________________________________
5 0
3 years ago
Read 2 more answers
All the gametes of isogamous organisms are genetically identical.<br><br> True<br> False
Lady bird [3.3K]

Answer:

False

Explanation:

Gametes are formed by meiotic division, and classified by shape, size and activity. In some species they are undifferentiated, that is, isogamous, resembling, but not identical, regardless of gender. However, most species have heterogeneous gametes (anisogamy), differentiated by morphological, dimensional and mobility aspects.

6 0
3 years ago
Other questions:
  • A scientist finds a new life form and determines that it performs photosynthesis. Which of the 6 kingdoms could it belong to? Se
    13·2 answers
  • What degree does a cat scan technologist have?
    5·1 answer
  • Which of the following shows the levels of organization in a multi-cellular organism from the smallest level to the largest?
    11·1 answer
  • What chromosome is skin cancer located in?
    13·1 answer
  • Sharks obtain all of their energy by eating other marine organisms, such as fish. Suppose that a marine scientist measures the c
    5·1 answer
  • Which of the following kingdoms contains prokaryotes?
    8·2 answers
  • What is the trait that is ancestral to all chordates?
    13·2 answers
  • This makes AA unique <br>T group<br>R group<br>acetic<br>mentum
    8·1 answer
  • What information does a food pyramid describe that a food web does not?
    8·2 answers
  • what are the chances that a color blind man will have a color blind grandson what are the genotypes for all involved.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!