1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oxana [17]
3 years ago
11

Please help me, please i really need it :)

Chemistry
1 answer:
Mekhanik [1.2K]3 years ago
4 0

GGCCATAGGTCCCTTTAGCG

I believe this is correct (I used the complementary base)

You might be interested in
A 59.1 sample of aluminum is put into a calorimeter (see sketch at right) that contains of water. The aluminum sample starts off
Gemiola [76]

Answer:

Specific heat capacity of aluminium is 0,863 J/g°C

Explanation:

<em>Values: 250g of water, aluminum sample starts off at 91.3°C, water starts off at 16.0°C, temperature of the water stops changing it's 19.5°C</em>

In this problem, the heat produced for the aluminium is the same consumed by water. The heat consumed by water is:

Q = C×m×ΔT <em>(1)</em>

Where C is specific heat of water (4,184J/g°C), m is mass of water (250,0g) and ΔT is change in temperature of water (19,5°C-16,0°C = 3,5°C)

Replacing:

Q = 4,184J/g°C×250,0g×3,5°C

<em><u>Q = 3661 J</u></em>

Using (1), it is possible to obtain specific heat of aluminium, thus:

Q / (m×ΔT) = C

Where Q is heat (3661J), m is mass (59,1g) and ΔT is change in temperature (91,3°C - 19,5°C( = 71,8°C

Replacing:

3661J / (59,1g×71,8°C) = C

<em>C = 0,863 J/g°C</em>

I hope it helps!

4 0
3 years ago
calculate the ph of a 0.020 m carbonic acid solution, h2co3(aq), that has the stepwise dissociation constants ka1
fgiga [73]

The calculated pH is 3.79. therefore, the solution is acidic.

No, carbonic acid is not a strong acid. H2CO3 is a weak acid that dissociates into a proton (H+ cation) and a bicarbonate ion (HCO3- anion). This compound only partly dissociates in aqueous solutions.

H2 CO3    =    H (+) + HCO3(-)          Ka1 = 4.3 * 10^ -7

   0.06 - x              x          x

Ka1 = x^2 / (0.06 - x) = 4.3 * 10^ - 7

A low Ka => x << 0.06 => 0.06 -x ≈ 0.06

=> Ka1 ≈ x^2 / 0.06 => x^2 ≈ 0.06 * Ka1 = 0.06 * 4.3 * 10^-7

=> x ≈ √ [ 2.58 * 10 ^ -8] = 1.606 * 10^ - 4 = 0.0001606

Second dissociation

HCO3(-)    =   H (+) + CO3(2-)         Ka2 = 5.6 * 10^ - 11

0.0001606 - y            y             y

Ka2 ≈ y^2 / 0.0001606 => y = √ [0.0001606 * 5.6* 10^ -11]

y = 9.48 * 10^ -8

An acidic solution has a high concentration of hydrogen ions (H +start superscript, plus, end superscript), greater than that of pure water.

[H+] = x + y = 1.607 * 10^ -4

pH = - log [H+] = 3.79

Learn more about concentration here-

brainly.com/question/10725862

#SPJ4

5 0
2 years ago
How are the concentrations of hydrogen ions and hydroxide ions related in an aqueous solution?
Jlenok [28]

Answer:

An Arrhenius acid increases the concentration of hydrogen (H+) ions in an aqueous solution, while an Arrhenius base increases the concentration of hydroxide (OH–) ions in an aqueous solution.

5 0
2 years ago
Read 2 more answers
A nucleotide consists of a phosphate group, a pentose sugar, and a __________________, all linked together by covalent bonds. po
Genrish500 [490]
The correct answer would be the fourth option. A nucleotide consists of a phosphate group, a pentose sugar, and a nitrogen containing base that are all linked together by covalent bonds. Nucleotides are the monomer units of nucleic acids and is the basic unit of the DNA.
5 0
3 years ago
Hii pls helpnme to write out the ionic equation ​
Oxana [17]

Answer:

CO32-(aq) + 2H+(aq) → CO2(g) + H2O(l)

Explanation:

According to this question, sodium carbonate reacts with sulfuric acid to form aqueous sodium sulfate, carbon dioxide and water. The balanced chemical equation is as follows:

Na2CO3(aq) + H2SO4(aq) → Na2SO4(aq) + CO2(g) + H2O(l)

- Next, split compounds that are aqueous into ions.

2Na+(aq) + CO32-(aq) + 2H+(aq) + SO42-(aq) → 2Na+(aq) + SO42-(aq) + CO2(g) + H2O(l)

- Next, we cancel out the spectator ions, which are ions that remain the same in the reactants and products side of a chemical reaction. The spectator ions in this equation are 2Na+(aq) and SO42-(aq).

CO32-(aq) + 2H+(aq) → CO2(g) + H2O(l)

- Hence, the balanced ionic equation is as follows:

CO32-(aq) + 2H+(aq) → CO2(g) + H2O(l)

3 0
3 years ago
Other questions:
  • A cubic centimeter is equal in volume to a _____.
    7·2 answers
  • Give the nuclear symbol (isotope symbol) for the isotope of bromine that contains 44 neutrons per atom. nuclear symbol:_________
    11·1 answer
  • Which equation demonstrates that nuclear fusion forms elements that are heavier than helium?
    10·1 answer
  • List 5 biotic factors inside of a classroom
    6·1 answer
  • When 4.96 g of a nonelectrolyte solute is dissolved in water to make 485 mL of solution at 27 °C, the solution exerts an osmotic
    5·1 answer
  • 2 NaOH (s) + CO2(g) → Na2CO3 (s) + H20 (I) How many grams of water can be produced with 1.85 moles of NaOH​
    7·2 answers
  • Will a block of material having a volume of 1.97 x 105 cm3 and weighing 1.59 kg float or sink when placed in water? Show calcula
    5·1 answer
  • Which reaction occurs when equivalent quantities of H" (or H30) and OH" are mixed?
    7·1 answer
  • What are the 3 most valuable metals in the United States? A. Lead b. Gold c. Iron d.Copper e.Coal f.Silver g.Titanium
    15·1 answer
  • What are 6 things you would do to a new substance to determine if it was a metal? I need help!
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!