Answer:
Mutualism
Explanation:
In biology, the term <em>symbiosis </em>refers to close and often long-term interactions between organisms that belong to different species. There are three main types of symbiotic relationships:
- mutualism - both organisms benefit from their relationship
- commensalism - one organism benefits, while the other doesn't benefit or suffer any harm
- parasitism - one organism causes harm to the other
In the given scenario, both the bird and plant benefit from their relationship. The bird gets food, while the plant reproduces more easily. This is why their relationship is an example of mutualism.
Answer:
The nucleus
Explanation:
Most DNA is located in the cell nucleus (where it is called nuclear DNA), but a small amount of DNA can also be found in the mitochondria (where it is called mitochondrial DNA or mtDNA). Mitochondria are structures within cells that convert the energy from food into a form that cells can use.
Hope this helps!
:)
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The treatment of serious psychological disorders with prescribed medications or medical procedures that directly influence the nervous system is called <u>biomedical therapy.
</u>It is a type of therapy where medicine is used to influence physiological issues in the body, so as to treat the psychological problems of the brain. There are various ways to do this, but the most "popular" ones are drug therapies, electroconvulsive (shock) treatment, as well as psychosurgery. <u>
</u>
Answer:
ATP stands for adenosine triphosphate, where three phosphoric acids attach themselves to provide high energy phosphate groups to it. This process of conversion of ADP to ATP is called as phosphorylation.
Explanation:
