A) hunting and habitat destruction
i believe the answer is B, Salt accumulates near the surface of the soil.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Secondary consumers as their prey are primary consumers.
The answer would be: cooperative interactions between the termites and the protozoa allow termites to extract <span>energy from wood to survive
The experiment shows that the termites lost the ability to digest wood when the protozoa that live in their gut is eliminated. The ability to digest wood will be back after the termites eat feces that contaminated with the same protozoa.
This shows that the protozoa have a symbiosis with the termite that gives the ability to digest the wood.</span>
