1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
2 years ago
9

Dexcribe how you imagined yourself trying to communicate without talking?

Biology
2 answers:
sergejj [24]2 years ago
5 0

Answer:

I would communicate with movement or body language

Andreyy892 years ago
3 0
You could communicate with body language or perhaps sign language.

I hope this helps.
You might be interested in
Hydrogen bonds can only occur between certain bases.
skad [1K]
A pairs with T (Thymine) 
C Pairs with G (Guanine)
6 0
3 years ago
Which statement best descnbes the relationship between photosynthesis and cellular respiration?
melisa1 [442]

Answer:

Photosynthesis removes carbon from the atmosphere, and cellular respiration releases carbon back into the atmosphere

Explanation:

7 0
3 years ago
Which level of life includes all of the other levels in this list: organisms, cells, biosphere, molecules, ecosystems?
Vladimir79 [104]

Answer:

Biosphere

Explanation:

The biosphere is the part of the earth that supports life forms. It includes hydrosphere, atmosphere, and lithosphere. Various ecosystems, aquatic or terrestrial, are present in the biosphere. Biotic and abiotic components of a geographical region that interact with each other together make an ecosystem.

The biotic component of an ecosystem includes all the organisms present in it. Organisms may be unicellular or multicellular. All the organisms are made up of one or more cells. Cells are made up of various biomolecules that interact and enable cells to perform the life processes.

5 0
3 years ago
What is the sequence of bases on DNA strand b from left to right<br> (See picture)
VLD [36.1K]

Answer:

DNA sequence from left to right

T G A G G A C T T

Explanation:

There are four DNA nitogenous base they include thymine, guanine, cytosine and Adenine. The Nitrogenous bases are complementary that is Adenine is complementary to thymine and cytosine is completely to quanine and they both can replace each other in this manner A-T,C-G and it means that Adenine can pair with thymine and cytosine can only pair with guanine. DNA is known as Deoxyribonucleic acid. DNA sequencing are shown usually from the 5' end to the 3' end . The sense strand in DNA is used in DNA sequences and also it has the antisense strand and also called the coding strand and the non-coding strand are information are contained in the sequence

3 0
3 years ago
Read 2 more answers
How many legs are on a antherpod
Ivanshal [37]
The number of legs that an arthropod has is a very useful characteristic for classifying them into different classes. Insects always have six legs<span> (three pairs) and arachnids have </span>eight legs<span> (four pairs). Crustaceans have at least </span>eight legs<span> and often more, while myriapods can have up to a hundred legs!</span>
3 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which statement best describes the dermis?
    10·1 answer
  • Things of the same species have similar morphology and can _____.
    7·1 answer
  • At what age do infants, start relying on others for signal about acceptable behavior, begin to show compliance to caregivers dem
    11·1 answer
  • The ciliated larval form of many mollusks is called the
    15·1 answer
  • "The complexity of life is based on cells as the building block that allows for emerging complexity."
    9·2 answers
  • Which of the following factors will most likely limit the light-dependent reactions of photosynthesis?
    12·2 answers
  • Which statement describes one or both formations?
    9·2 answers
  • Allport's belief that humans are primarily motivated by the need to satisy biological survival needs is referred to as "opportun
    5·1 answer
  • Need help I bad at science
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!