During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
The answer to your question is : the glucose in the kinetic energy is stored in potential energy in the ATP. After the kinetic energy would be released when the molecule moves across the cell membrane.
Hope this helps you!
Explanation:
Using MLA Style properly makes it easier for readers to navigate and comprehend a text through familiar cues that refer to sources and borrowed information. Editors and instructors also encourage everyone to use the same format so there is consistency of style within a given field.
When placed in tap water, which is a hypotonic environment, animal cells have a higher solute concentration inside of the cell compared to the tap water. ... This, however, is not the case for plant cells which has a strategy to prevent lysis when put in a hypotonic environment. So the answer to your question is D
