1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lora16 [44]
3 years ago
14

What is the value of 8 + 29 - 7 when g = 5?

Mathematics
1 answer:
Cloud [144]3 years ago
6 0

Answer:

which one is it id,k

Step-by-step explanation:

if its 8g+29-7 then it would be 62

if its 8+29g-7 then it would be 146

if its 8+29-7g then it would be 3

You might be interested in
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
What is the mean absolute deviation of 6 15 7 14 11 13 15 15
Anettt [7]
U gotta add all the numbers then divide them by the amount of numbers there are. So divide them by 8 after u add
3 0
3 years ago
What is the maximum safe angle of elevation for the resuce ladder
bazaltina [42]
65.4(degrees)

X=100'

I think
8 0
3 years ago
I need help with this math homework.. someone please help
tatuchka [14]
A rotation would also give you this transformation.
You could do a 90 degree counter-clockwise or a 270 degree clockwise
5 0
3 years ago
Find the value of x.
ratelena [41]

Answer:

value of x is 59.5

Step-by-step explanation:

Solution.

Given, Right angled triangle

where reference angle given 48

hypotenuse(h)=80

perpendicular(p)=x

Now ,

I) sin48=p/h

or,sin48×h=p

or0.978×80=x

.°. 59.5=x

4 0
3 years ago
Other questions:
  • What is 2/3 cup chopped nuts multiplied by 6 ?
    7·2 answers
  • Describe how to find all the points on a baseball field that are equidistant from second base and third base
    8·1 answer
  • What numerical expression has a value of 45
    9·2 answers
  • Which two numbers add up to 10 and multiply to -2000?
    8·1 answer
  • Jim divided -2 by an integer and his result was between -1 and 0. which integer could have been the divisor ?
    10·1 answer
  • READ NOW for prize details: You really want to add smoked sausages to your menu and feel that you'll sell 12 units a night at $9
    8·1 answer
  • Exit Ticket
    5·1 answer
  • How to use Cosine to calculate the side of a right triangle?
    9·1 answer
  • Which would be the better value?<br> A) 12 pens for $2.70<br> B) 16 pens for $3.40
    8·1 answer
  • Given the following exponential function, identify whether the change representsgrowth or decay, and determine the percentage ra
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!