Answer:
Explanation:
We can easily move the box from a ground floor though to the first floor at an angle of 40° to the horizontal by simply pushing the load through an inclined plane. We will simply be lean the inclined plane on the building at the required angle and the push through the the height of the building.
Based on the explanation above, the best type of simple machine to use is an INCLINED PLANE. <em>Note that the essence of using a machine is simply to make our work easier and faster and also be able to overcome a much larger load with a minimal effort. </em>
I think it C hope this helps
Explanation:
Wind energy is one of the sources of renewable sources of energy that is environmentally friendly.
It uses wind power to generate other forms of energy mostly electricity.
Some of the drawbacks are:
- Wind turbines pose serious threat to wildlife. It is common place to see dead birds in areas where wind power is being harnessed.
- The quantity fluctuates from time to time. Since wind is an element of weather, it is not always in regular supply as desired.
- The cost of constructing wind turbines can be very high a times.
Learn more:
Non-renewable sources of energy brainly.com/question/3386515
#learnwithBrainly
Answer:
Yes
Explanation:
subsidence will dry out an air mass by adiabatic or compression heating.
<h2>
<u><em>hope this helped you</em></u></h2><h2>
<u><em>please mark me as brainiest</em></u></h2>
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
