1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
diamong [38]
3 years ago
13

1. What is the difference between rocks and minerals?

Biology
1 answer:
ivann1987 [24]3 years ago
8 0

1-A mineral is a naturally occurring inorganic element or compound having an orderly internal structure and characteristic chemical composition, crystal form, and physical properties. ... A rock is an aggregate of one or more minerals, or a body of undifferentiated mineral matter.

2-Part of Hall of Planet Earth. There are three kinds of rock: igneous, sedimentary, and metamorphic.

3-Intrusive rocks are formed from magma that cools and solidifies within the crust of the planet. When lava comes out of a volcano and solidifies into extrusive igneous rock, also called volcanic, the rock cools very quickly.

4-Igneous rocks are formed from lava or magma. Magma is molten rock that is underground and lava is molten rock that erupts out on the surface. The two main types of igneous rocks are plutonic rocks and volcanic rocks. Plutonic rocks are formed when magma cools and solidifies underground.

You might be interested in
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Birds are washed right away
lora16 [44]
Yes!You are corrected
4 0
3 years ago
a)Explain one positive step you could take to reduce your risk of coronary heart disease in later life.
dangina [55]
You can start eating healthy now and exersize and stay away from bad foods.
4 0
3 years ago
HELP ME PLEASE PLEASE PLEASE
Korvikt [17]

Answer:

<h3>mitosis</h3>

Explanation:

the cell divison which gives 2 daughter cells from one parent cell is mitosis it takes place in body cromosomes or in autosomal or in somatic cells

3 0
3 years ago
Cuales son los elementos de la biodiversidad ???
ollegr [7]

Tres elementos de la biodiversidad. La diversidad de espacios incluye los ecosistemas como núcleo central. Éstos son conjuntos dinámicos de plantas, hongos, animales, microorganismos y el medio físico que los rodea, interactuando como una unidad funcional; por eso se les denomina «ecosistemas».

3 0
3 years ago
Read 2 more answers
Other questions:
  • An animal's somatic cells contain 2n chromosomes. What happens to the number of chromosomes in the animal's gametes? The number
    5·1 answer
  • How do pseudopods work?
    10·1 answer
  • Which one of the following is produced during the process of aerobic cellular respiration? cytosol sugars oxygen carbon dioxide
    8·2 answers
  • How to grow edible mushrooms in a lab or in home environment .
    7·1 answer
  • One codon has the instructions to make
    9·1 answer
  • Help me please this is a graded quiz! ​
    8·1 answer
  • What do plants produce when they make their own food?​
    15·2 answers
  • Green plants take in oxygen and water, use them to produce food, and give off carbon dioxide.
    12·1 answer
  • The process which controls the future of cells is
    5·1 answer
  • One of the most important rain forest predators, attacking a wide range of different primates, is the monkey-eating eagle. We kn
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!