1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alchen [17]
2 years ago
10

Find locally available materials that can be used in cleaning of the various body parts of the body.​

Biology
1 answer:
artcher [175]2 years ago
7 0

Answer:

In the body, a water purifier may encourage everyone to drink more good old ... It can literally clean almost anything it touches, so stock up and enjoy its many uses. ... To learn more about your health and wellness, see your local chiropractor at ..

Explanation:

In the body, a water purifier may encourage everyone to drink more good old ... It can literally clean almost anything it touches, so stock up and enjoy its many uses. ... To learn more about your health and wellness, see your local chiropractor at ..

You might be interested in
Discuss why biologists might have a difficult time classifying this organism
Scrat [10]

Answer:

Explanation:Explanation: Classification of organisms is a hard task cause many organisms have their differences and similarities, whereby making it very complicated in classifying organisms.. All living organisms are classified into groups based on very basic, shared characteristics

8 0
3 years ago
Which of the following is a main difference in cell structure between an onion cell and a human cheek cell? A. An onion cell con
USPshnik [31]
The correct answer is "C".

Onion cell is a plant cell and human cheek cell is an animal cell. Hence, onion cell has a cell wall<span> but not in human cheek cells because animal cells do not have cell wall. Both cells have single nucleus. Since, human cheek cell is an animal cell, chloroplasts are cannot be seen in the human cheek cells.</span>
5 0
3 years ago
Read 2 more answers
Order the steps of the urine formation process
ELEN [110]

Answer:

Filtration, Reabsorption, Secretion: The Three Steps of Urine Formation. The kidneys filter unwanted substances from the blood and produce urine to excrete them. There are three main steps of urine formation: glomerular filtration, reabsorption, and secretion.

Explanation:

6 0
3 years ago
Read 2 more answers
All of the following are stops on the pathway of taste signals except __________.
Troyanec [42]

B. The prefrontal cortex is used to plan complex cognitive behavior, personality expresison, and moderate social behavior.

8 0
2 years ago
Read 2 more answers
Which statements best describe gases
Neko [114]
Could you attach the statements so i can answer :)
5 0
3 years ago
Other questions:
  • What do we call the solution of nutrients and organelles
    15·1 answer
  • Bacteria living in a freshwater stream that are moved to salty seawater would
    12·1 answer
  • Lysogeny is associated with all of the following except __________.
    11·1 answer
  • Suggest a reason for the rather large energy excess available in the insertion of a deoxyribonucleotide into a growing DNA molec
    5·1 answer
  • How high is this baby on LSD?​
    15·1 answer
  • Lead toxicity is more common in low-income children because lead is not as well absorbed when other minerals are lacking. low in
    13·1 answer
  • Which of the following alternative engery technologies is most likey to be used to power a car?
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Where do plants get the carbon dioxide they need for photosynthesis to begin?
    10·1 answer
  • Where would you most likely find nitrogen-fixing bacteria?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!