The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Answer:
<em>The correct option is D) The expression of certain genes is affected by temperature.</em>
Explanation:
There are various factors which control the regulation of a gene. Temperature can be a regulatory factor for certain genes.
Probably, during the warm temperatures, the proteins regulating the fur colour to become reddish brown become activate these genes. As a result, the fur becomes evident.
In the winter, the enzymes controlling the fur might become degraded. A s a result, the genes are not able to express themselves. Hence, a white coat occurs.
Producers are organisms (usually plants) that utilize photosynthesis to produce their own food supply.
Photosynthesis is a process that uses photons from the sunlight to turn glucose and oxygen into carbon dioxide and energy. It basically is a process that uses light energy to make a usable food source, and it takes place in the cells of a chloroplast.
Chlorophyll is a green pigment found inside of plants' chloroplasts that absorbs light photons, allowing photosynthesis to take place.
The relative humidity of a dry-bulb temperature of 15°C and a wet-bulb temperature of 12°C is 71%.
<h3>What do you mean by Relative Humidity?</h3>
Relative humidity may be defined as the proportion of atmospheric moisture present compared to the amount that would be present if the air were permeated.
Relative humidity can be calculated by subtracting the temperature of the dry bulb from the temperature of the wet bulb.
After getting a specific value, refer to the relative humidity chart at the particular value of the dry-bulb temperature.
Therefore, the relative humidity of a dry-bulb temperature of 15°C and a wet-bulb temperature of 12°C is 71%.
To learn more about Relative temperature, refer to the link:
brainly.com/question/21494654
#SPJ1
The answer is copper. Nonrenewable resources are those that cannot be readily/naturally replaced at rates that match those of consumption (an aspect that allow renewable resources to be sustainable). Copper are made deep in earth at very slow rates hence do not readily renew themselves. Organisms, on the other hand die, and are naturally replaced by offspring.