1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreas93 [3]
3 years ago
14

9. Write another analogy that describes the process of electron carriers.

Biology
1 answer:
uranmaximum [27]3 years ago
6 0

Answer:

Electron carriers can be in oxidized or reduced form. NAD+ is the oxidized form of electron carrier. FAD is another example of electron carrier. In regards to analogy, laundry basket with warm laundry.

Explanation:

The electron carriers travels from higher energy or higher electron level to lower energy or lower electron level. The laundry basket which contains warm laundry shows astonishing analogy to the process of electron carriers. The laundry basket here is represented by the electron carrier. The electrons in higher energy level are represented by the warm laundry that have undergone through a process of highly energy generative movements.

You might be interested in
Humans, dimples are a dominant trait. Predict the percentage of children that will have dimples if one parent is heterozygous fo
alexandr402 [8]

Answer:

1) 50 percent

2) 50 percent

Explanation:

6 0
2 years ago
In humans, the DMD gene is required for proper muscle function. Mutations in the DMD gene display X-linked recessive inheritance
ANEK [815]

Answer:

Explanation:

As the inheritance is X-linked,recesson so for expression of muscular dystrophy in any given muscle,

\frac{enh1-    enh2+   enh3 -   DMD+ }{enh1-    enh2+   enh3 +   DMD+}

enh1+ /enh1 + = Shows muscular dystrophy in heart (Homozygous for -)

enh2+/enh2+ = Shows no muscular dystrophy in arms (Homozygous for +)

enh3-/enh3+ = variabl or mosaic for muscular dystrophy in leg muscles (Hetrozygous for enh3)

8 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
3. The plantlets have a different genetic code from the parent plant.
wolverine [178]

Answer:

The plantlets have a different genetic code from the parent plant. This represents asexual reproduction. The plantlets are the same size as the parent plant.

Explanation:

4 0
3 years ago
Read 2 more answers
Which statement correctly explains the polarity of the water molecule?. A) The hydrogen end of the molecule has a partial negati
Goshia [24]
A Hydrogen has a negative charge of -1 and o is positive and also neutral
8 0
3 years ago
Other questions:
  • Explain what you believe may have happened to the ecosystem in year 6 from the Ecosystem Study graph above.
    10·1 answer
  • The client who experiences residual arm pain after a fall has been referred to an acupuncture treatment center. what is the nurs
    11·1 answer
  • Predict: logging removes vegetation that anchors soil and prevents erosion. how do you think logging will affect a coral reef? e
    10·1 answer
  • Which of the following statements about cyst formation is true?
    14·2 answers
  • Energy for the cell’s use is stored when?
    5·2 answers
  • What is the main purpose of the light independent reaction
    6·1 answer
  • You are looking at the natural factors that affect the Earth’s climate change.
    14·1 answer
  • You have been asked to help a top nutrition researcher conduct human experiments on vitamin
    13·1 answer
  • Means middle level clouds
    13·1 answer
  • What is a sedimentary rock?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!