Answer:
Climate change is rapidly becoming known as a tangible issue that must be addressed to avoid major environmental consequences in the future. Recent change in public opinion has been caused by the physical signs of climate change–melting glaciers, rising sea levels, more severe storm and drought events, and hotter average global temperatures annually. Transportation is a major contributor of carbon dioxide (CO2) and other greenhouse gas emissions from human activity, accounting for approximately 14 percent of total anthropogenic emissions globally and about 27 percent in the U.S.
Fortunately, transportation technologies and strategies are emerging that can help to meet the climate challenge. These include automotive and fuel technologies, intelligent transportation systems (ITS), and mobility management strategies that can reduce the demand for private vehicles. While the climate change benefits of innovative engine and vehicle technologies are relatively well understood, there are fewer studies available on the energy and emission impacts of ITS and mobility management strategies. In the future, ITS and mobility management will likely play a greater role in reducing fuel consumption. Studies are often based on simulation models, scenario analysis, and limited deployment experience. Thus, more research is needed to quantify potential impacts. Of the nine ITS technologies examined, traffic signal control, electronic toll collection, bus rapid transit, and traveler information have been deployed more widely and demonstrated positive impacts (but often on a limited basis). Mobility management approaches that have established the greatest CO2 reduction potential, to date, include road pricing policies (congestion and cordon) and carsharing (short-term auto access). Other approaches have also indicated CO2 reduction potential including: low-speed modes, integrated regional smart cards, park-and-ride facilities, parking cash out, smart growth, telecommuting, and carpooling.
Explanation:
Answer:
transport of protons (H+) from low concentration in the mitochondrial matrix to high concentration in the mitochondrial intermembrane space
Explanation:
atpase pump can also be called atp synthase. this enzyme catalyses atp formation from adenosine diphosphate and phosphate. it has f1, stalk and f0 components. 3 positive hydrogen ions go through to make 1 adenosine triphosphate molecule. oxidative phosphorylation has to do with the loss of electrons. there would be electrons loss from NADH to FADH2. Cytochromes carries them through different series of transferases from I to IV and while on this positive hydrogen ions are released into mitochondrial matrix
positive hydrogen ions are moved back to lumen through adenosine triphosphate channels. a process called chemiosmosis. the pro
Answer:
Neurulation of organogenesis is the last stage of human development. The gastrula stage forms three germ layers called ectoderm, mesoderm, and endoderm
Answer:
A. Organ.
Explanation:
Cells make up
tissues, tissues make up an organ. Organs make organ system
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
