1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eimsori [14]
2 years ago
10

Which process most increases the amount of phosphorus available for use in the ecosystem?

Biology
1 answer:
fgiga [73]2 years ago
4 0
The overuse of fertilizers and over-enrichment with nutrients will lead to increasing the amount of phosphorus concentration in agricultural runoff.
You might be interested in
Consider the events that describe the progress of a protein that will be secreted from the cell. 1. SRP binds to the growing pol
Sphinxa [80]

Answer: the answer is option A. 5 → 1 → 6 → 3 → 2 → 4

Explanation: the events that describe progress of a protein that will be secreted from cell are as follows; Protein synthesis begins in the cytosol,  SRP binds to the growing polypeptide chain and to the ribosome, Translation pauses,  SRP binds to its receptor,   Translation resumes and finally - The signal sequence is cleaved. All these formed the sequence 5 → 1 → 6 → 3 → 2 → 4

6 0
3 years ago
What is one reason people used to think that nothing could live deep down in the ocean
Tomtit [17]

Answer:

One reason is that there was too much pressure in the bottom of the ocean, from all the water pressing together.

hope this helps :)

Explanation:

7 0
3 years ago
Which of the following is a function of the vertebral column? Select one: a. It supports the weight of the body. b. It allows sp
lisov135 [29]

Answer:

<h2>b. It allows spinal nerves to exit the spinal cord. </h2>

Explanation:

  • The vertebral column is an important characteristic of vertebrates.
  • The formation of the vertebral column takes place from the notochord in the vertebrate.
  • The vertebral column is also known as the spine or generally called the backbone.
  • It forms the spinal canal that is responsible to provide protection to the spinal cord.
  • The vertebral column is divided into many regions into human beings and some other organisms according to its function and position.
  • It has many functions such as protection of the spinal cord, allow passes of spinal nerves and some other.

5 0
3 years ago
Which two kinds of information can scientists gather using radar?
makkiz [27]

The correct answers are C. Amount of rainfall, and D. Wind speed.

Explanation

Radars are instruments that were created by humans to detect objects, people, places, among others, through signals. Radars are devices used in different fields such as war, aviation, climatology, geography, among others. One of the best known is the Doppler radar, which is a climatological tool that is used to detect the intensity, size, quantity, and direction of rainfall. Likewise, rainfall is influenced by the direction and speed of the wind, data that can also be obtained using this tool. One of the purposes for which this object was created was the early detection of natural phenomena related to rains, and winds such as hurricanes, electric storms, hail, among others. Therefore, the two objects that scientists can obtain with a radar are C. Amount of rainfall, and D. Wind speed.

4 0
3 years ago
The statement “force equals mass times acceleration (F=ma)” is Newton’s second law of motion. Why is this a law rather than a th
RideAnS [48]

Answer:

Explanation:

it is A

3 0
3 years ago
Read 2 more answers
Other questions:
  • When in the cell cycle does independent assortment of chromosomes occur?
    6·1 answer
  • Cultural traits are transmitted horizontally and vertically through learning. which of the examples below shows the horizontal t
    5·1 answer
  • The first class of antiviral drugs developed to treat hiv infection, such as azt, were known as reverse transcriptase inhibitors
    9·1 answer
  • 20. Neutrons and<br> are found in the nucleus of an atom. (1 point)
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How does mass play a role in the life cycle of a star? Use atleast 3 specific examples from the stages in the life cycle of a st
    14·2 answers
  • “blank” investigations are best for demonstrating cause-and-effect relationships. a. descriptive b.comparative c. experimental
    13·1 answer
  • Does endoctosis use energy​
    10·1 answer
  • When the availability of resources in an area is limited, organisms may leave a population to move to an area with more resource
    14·2 answers
  • SOMEONE SMART PLS HELP!!!!! If 1 kg of fuel is used in the above fusion reaction, the resulting helium has a mass of 0.993 kg. I
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!