1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adell [148]
3 years ago
11

What is meant by “gross examination”?

Biology
1 answer:
Veronika [31]3 years ago
4 0

Answer:

Hi there, your answer is B

Explanation:

Gross examination deals with looking at specimens with the naked eye that includes able to diagnosis a certain sickness by looking at the affected organ you can see if that organ had a tumor or other problems.

Hope that helped :)

You might be interested in
the atomical plane denoting the vertical field running through the body from front to back dividing the body into the right and
sineoko [7]

Answer:

sagittal.........

3 0
3 years ago
What is not a reason why cell divide
Zielflug [23.3K]
Idk but you can ask google and I'm sure they will tell you
4 0
3 years ago
Please answer the picture
Oksana_A [137]
2, 4, 1, 3, 5

the tiles go into the sequence in that order.

first one is tile 2, second is tile 4, etc.
4 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Some animals are adapted to survive in very cold conditions such as the Arctic.
iVinArrow [24]

Answer: they grow thick fur for insulation which is also oily and they have a layer of fat which keeps their get inside their body to keep them warm for longer

Explanation:

6 0
3 years ago
Other questions:
  • ASAP WILL GIVE BRAINLEST
    5·2 answers
  • Evolution and natural selection are necessary for A) the preservation of natural habitats. B) the short-term survival of individ
    9·2 answers
  • The ability of the pupils to return to normal in low-light conditions is known as __________ .
    6·2 answers
  • Which part of the water do lancelets inhabit?
    8·2 answers
  • Landforms is a physical feature on earth's surface true or false
    11·2 answers
  • Where is aggregate generally found? Check all that apply.
    13·1 answer
  • What fraction of their genetic material does each parent give to their child? Explain why.
    14·1 answer
  • Water vapor is important because it helps air hold: PLEASE HELP THIS IS A QUIZ. and please dont answer if u dont know the answer
    15·1 answer
  • Select the correct answer.
    8·2 answers
  • Which of the following is the disadvantage of sexual reproduction?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!